Облучатель угн 1: Облучатель ОУФНУ (УГН-1) | Купить в интернет-магазине Тандем-Мед

alexxlab | 25.07.1986 | 0 | Разное

Содержание

Облучатель УГН-1

Облучатель УГН-1 (устаревшее наименование Аппарат ОУФну используется для лечения верхних дыхательных путей (полостей носа, носоглотки, миндалин) и полости уха. С помощью пластиковых тубусов поток ультрафиолетовых лучей фокусируется в облучателе ОУФну для всех видов облучений.)

УГН-1 представляет собой стационарный ультрафиолетовый терапевтический облучатель для групповых локализованных облучений до 4 пациентов одновременно. 
В качестве источника УФ-излучения в облучателе ОУФну используется ртутно-кварцевая лампа высокого давления ДРТ-240 , излучающая ультрафиолетовые лучи широкого диапазона (240–320 нм).
Индивидуальные зеркала позволяют наблюдать за направлением потока лучей при работе облучателя. Специальные шторки разделяют зону на четыре сектора, что удобно для пациентов.

Технические характеристики 
Облученность в выходном отверстии тубуса для рта при горизонтальном положении тубуса и полностью выдвинутом переходнике (Вт/м²)

40±10

Напряжение питающей сети (В)

220±22

Частота (Гц)

50

Мощность не более (В·А)

1000

Длительность пускового режима лампы не более (мин)

15

Масса не более (кг)

11

Класс защиты от поражения электрическим током по ГОСТ Р 50267.0-92

I тип B

Вид климатического исполнения по ГОСТ 15150-69

УХЛ4.2

Средний срок службы не менее (лет)

5

 

Комплектность аппарата УГН-1 при поставке: облучатель в собранном виде (без тубусов, кронштейнов и шторок), тубус для рта — 4 шт., тубус для носа — 4 шт., тубус для миндалин — 4 шт., заглушка (колпачек) на место тубуса — 4 шт., кронштейн для крепления шторок — 4 шт., шторка тканевая — 4 шт., инструкция по эксплуатации 82-00-00РЭ, вставка плавкая (предохранитель) ВП2Б-1-6,3А — 2 шт.
Ультрафиолетовые лучи биологически весьма активны и при неумелом использовании облучателя ОУФну (УГН-1) могут причинить пациенту серьезный вред. Поэтому медперсонал должен обслуживать пациентов только по врачебному предписанию с точным указанием дозировки.
При длительной работе облучателя ОУФну может ощущаться характерный запах озона. В этом случае рекомендуется выключить аппарат и проветрить помещение.
Через каждые два часа непрерывной работы необходимо выключать облучатель ОУФну на 20–30 минут. На время перерыва, не превышающего 30 минут, аппарат выключать не рекомендуется, так как повторное зажигание возможно только после охлаждения лампы ДРТ-240.

лабораторное, медицинское, торговое оборудование со склада

Облучатель ультрафиолетовый стационарный для облучения верхних дыхательных путей и полости уха групповой четырехместный.

Облучатель ультрафиолетовый стационарный ОУФну (ранее выпускался под названием УГН-1) предназначен для облучения верхних дыхательных путей (полостей носа, носоглотки, миндалин) и полостей уха одновременно четырем пациентам в физиотерапевтических кабинетах лечебных учреждений. Облучатель ОУФну представляет собой стационарный ультрафиолетовый терапевтический облучатель для групповых локализованных облучений до 4 пациентов одновременно.

Поток ультрафиолетовых лучей концентрируется в облучателе ОУФну с помощью пластиковых тубусов для всех видов облучений.
В качестве источника ультрафиолетового излучения в облучателе ОУФну используется ртутно-кварцевая лампа высокого давления ДРТ-240, излучающая ультрафиолетовые лучи широкого диапазона (240–320 нм).
Индивидуальные зеркала позволяют наблюдать за направлением потока лучей при работе облучателя. Специальные шторки разделяют рабочую зону на четыре сектора, что удобно для пациентов.

Технические характеристики облучателя ультрафиолетового ОУФну групповых облучений (старое название УГН-1):
Облученность в выходном отверстии тубуса для рта при горизонтальном положении тубуса и полностью выдвинутом переходнике (Вт/м2)40±10
Напряжение питающей сети (В)220±22
Частота (Гц)50
Мощность не более (В·А)1000
Источник излучениялампа ДРТ-240
Длительность пускового режима лампы не более (мин)15
Масса не более (кг)11
Габариты с установленными тубусами, мм
высота, мм:
диаметр основания, мм
1000х1000х1000
540±20
280±50
Класс защиты от поражения электрическим током по ГОСТ Р 50267.0-92I тип B
Вид климатического исполнения по ГОСТ 15150-69УХЛ4.2
Средний срок службы не менее (лет)5

Комплектность аппарата ОУФну (УГН-1) при поставке:
облучатель в собранном виде (без тубусов, кронштейнов и шторок),
лампа ДРТ-240 — 1 шт.,

тубус для рта — 4 шт.,
тубус для носа — 4 шт.,
тубус для миндалин — 4 шт.,
заглушка (колпачок) на место тубуса — 4 шт.,
кронштейн для крепления шторок — 4 шт.,
шторка тканевая — 4 шт.,
инструкция по эксплуатации 82-00-00РЭ,
вставка плавкая (предохранитель) ВП2Б-1-6,3А — 2 шт.

Медперсонал должен отпускать процедуры пациентам только по назначению врача с точным указанием дозировки.
Через каждые два часа непрерывной работы необходимо выключать облучатель ОУФну на 20–30 минут. На время перерыва, не превышающего 30 минут, аппарат выключать не рекомендуется, так как повторное зажигание возможно только после охлаждения лампы ДРТ-240.

Облучатель ОУФну (УГН-1) ртутно-кварцевый, цена 29440 грн

Облучатель ОУФну (устаревшее наименование УГН-1) представляет собой стационарный ультрафиолетовый терапевтический облучатель для групповых локализованных облучений до 4 пациентов одновременно. 

Аппарат ОУФну предназначен для лечения верхних дыхательных путей (полостей носа, носоглотки, миндалин) и полости уха. Поток ультрафиолетовых лучей концентрируется в облучателе ОУФну с помощью 

пластиковых тубусов для всех видов облучений (ниже их можно купить/заказать). 

В качестве источника УФ-излучения в облучателе ОУФну используется ртутно-кварцевая лампа высокого давления ДРТ-240 (ниже её также можно купить/заказать), излучающая ультрафиолетовые лучи широкого диапазона (240–320 нм). 

Индивидуальные зеркала позволяют наблюдать за направлением потока лучей при работе облучателя. Специальные шторки разделяют зону на четыре сектора, что удобно для пациентов. 
 

Таблица 1 — Технические характеристики медицинского оборудования Облучатель ОУФну (УГН-1)

Наименование

Значение

Облученность в выходном отверстии тубуса для рта при горизонтальном положении тубуса и полностью выдвинутом переходнике (Вт/м²)

40±10

Напряжение питающей сети (В)

220±22

Частота (Гц)

50

Мощность не более (В·А)

1000

Длительность пускового режима лампы не более (мин)

15

Масса не более (кг)

11

Класс защиты от поражения электрическим током по ГОСТ Р 50267.0-92

I тип B

Вид климатического исполнения по ГОСТ 15150-69

УХЛ4.2

Средний срок службы не менее (лет)

5


Комплектность аппарата ОУФну (УГН-1) при поставке: облучатель в собранном виде (без тубусов, кронштейнов и шторок), тубус для рта — 4 шт., тубус для носа — 4 шт., тубус для миндалин — 4 шт., заглушка (колпачек) на место тубуса — 4 шт., кронштейн для крепления шторок — 4 шт., шторка тканевая — 4 шт., инструкция по эксплуатации 82-00-00РЭ (
ниже её можно скачать с нашего сайта
), вставка плавкая (предохранитель) ВП2Б-1-6,3А — 2 шт. 

Ультрафиолетовые лучи биологически весьма активны и при неумелом использовании облучателя ОУФну (УГН-1) могут причинить пациенту серьезный вред. Поэтому медперсонал должен обслуживать пациентов только по врачебному предписанию с точным указанием дозировки. 

При длительной работе облучателя ОУФну может ощущаться характерный запах озона. В этом случае рекомендуется выключить аппарат и проветрить помещение. 

Через каждые два часа непрерывной работы необходимо выключать облучатель ОУФну на 20–30 минут. На время перерыва, не превышающего 30 минут, аппарат выключать не рекомендуется, так как повторное зажигание возможно только после охлаждения лампы ДРТ-240. 

Облучатель ртутно-кварцевый УГН-1 (ОУФну) от Медлайф+: выгодная цена, гарантия качества

Описание

Характеристики

Облучатель ультрафиолетовый стационарный для облучения верхних дыхательных путей и полости уха групповой четырехместный.

Облучатель ультрафиолетовый стационарный ОУФну (ранее выпускался под названием УГН-1) предназначен для облучения верхних дыхательных путей (полостей носа, носоглотки, миндалин) и полостей уха одновременно четырем пациентам в физиотерапевтических кабинетах лечебных учреждений. Облучатель ОУФну представляет собой стационарный ультрафиолетовый терапевтический облучатель для групповых локализованных облучений до 4 пациентов одновременно. 
Поток ультрафиолетовых лучей концентрируется в облучателе ОУФну с помощью пластиковых тубусов для всех видов облучений. 
В качестве источника ультрафиолетового излучения в облучателе ОУФну используется ртутно-кварцевая лампа высокого давления ДРТ-240, излучающая ультрафиолетовые лучи широкого диапазона (240–320 нм). 
Индивидуальные зеркала позволяют наблюдать за направлением потока лучей при работе облучателя. Специальные шторки разделяют рабочую зону на четыре сектора, что удобно для пациентов.
Технические характеристики облучателя ультрафиолетового ОУФну групповых облучений (старое название УГН-1):
Облученность в выходном отверстии тубуса для рта при горизонтальном положении тубуса и полностью выдвинутом переходнике (Вт/м2)40±10
Напряжение питающей сети (В)220±22
Частота (Гц)50
Мощность не более (В·А)1000
Источник излучениялампа ДРТ-240
Длительность пускового режима лампы не более (мин)15
Масса не более (кг)11
Габариты с установленными тубусами, мм
высота, мм:
диаметр основания, мм
1000х1000х1000
540±20
280±50
Класс защиты от поражения электрическим током по ГОСТ Р 50267.0-92I тип B
Вид климатического исполнения по ГОСТ 15150-69УХЛ4.2
Средний срок службы не менее (лет)
Страна производительРоссия

Облучатель ультрафиолетовый стационарный ОУФну (Облучатель УГН-1) — ТД АРМАДА

Описание

Технические характеристики

Облучатель ультрафиолетовый стационарный ОУФну (Облучатель УГН-1)

Облучатель ультрафиолетовый стационарный ОУФну (Облучатель УГН-1). Цена продукта: 52500 р.
Облучатель ультрафиолетовый стационарный ОУФну применяется для лечения верхних дыхательных путей (полостей носа, носоглотки, миндалин) и полости уха. В качестве источника излучения используются лампы высокого давления дрт-240.
Особенности и преимущества облучателя ОУФну

Возможность проведения процедуры лечения одновременно четырем пациентам;
Индивидуальные зеркала позволяют наблюдать за направлением потока лучей;
Шторки, разделяющие зону на четыре сектора, делают процедуру более удобной для пациентов;
Технические характеристики облучателя ОУФну

Напряжение питающей сети, В 220
Частота тока, Гц 50
Потребляемая мощность, не более, В-А 1000
Длительность пускового режима лампы, мин 15
Габаритные размеры с установленными тубусами, мм 1000х1000
Гарантия 12 месяцев
Габаритные размеры: 1000х1000 мм

Вес, кг: 11

Облучатель ультрафиолетовый стационарный ОУФну имеет Регистрационное Удостоверение РФ и Сертификат ГОСТ РФ

Облучатели

«LT MEDSUN Psoriasis» (15W) ультрафиолетовый (LightTech, США-Венгрия)

Внимание, откроется в новом окне.Печатьmedsun_Цена продукта: 1500 р.
Отправить запрос
Подробнее: «LT MEDSUN Psoriasis» (15W) ультрафиолетовый (LightTech, США-Венгрия)
Облучатель ультрафиолетовый кварцевый ОУФК-01

Облучатель ультрафиолетовый кварцевый ОУФК-01-Солнышко (аналог ОКН-11М)
Облучатель ОУФК-01 «Солнышко выполнен как сборный металлический корпус, в котором установлена ртутно-кварцевая лампа типа ДРТ 125-1 (источник ультрафиолетового излучения). Область применения облучателя «Солнышко включает лечение воспалительных заболеваний (ангина, ринит любого происхождения, отит, аллергический насморк, фурункул слухового прохода и т.д.), кожных и ряда других заболеваний внутриполостным облучением. Применяться Облучатель ОУФК-01 может как в лечебных, лечебно-профилактических, санаторно-курортных учреждениях, так и на дому.

Облучатель ультрафиолетовый стационарный ОУФну (Облучатель УГН-1).

Облучатель ультрафиолетовый стационарный ОУФну (Облучатель УГН-1).Цена продукта: 31850 р.
Облучатель ультрафиолетовый стационарный ОУФну применяется для лечения верхних дыхательных путей (полостей носа, носоглотки, миндалин) и полости уха. В качестве источника излучения используются лампы высокого давления дрт-240.

Облучатель ртутно-кварцевый ОРК-21М на штативе

Цена : 32300 р.
Облучатель ртутно-кварцевый УГН-01М стационарный

Поставщик: ТД АРМАДА

Облучатель ОУФну – ООО “КОМПАНИЯ САЛЮТЕМ”

Описание

Облучатель ОУФну (устаревшее наименование УГН-1) представляет собой стационарный ультрафиолетовый терапевтический облучатель для групповых локализованных облучений до 4 пациентов одновременно.

Аппарат ОУФну предназначен для лечения верхних дыхательных путей (полостей носа, носоглотки, миндалин) и полости уха. Поток ультрафиолетовых лучей концентрируется в облучателе ОУФну с помощью пластиковых тубусов для всех видов облучений

В качестве источника УФ-излучения в облучателе ОУФну используется ртутно-кварцевая лампа высокого давления ДРТ-240 (ниже её также можно купить/заказать), излучающая ультрафиолетовые лучи широкого диапазона (240–320 нм).

 Индивидуальные зеркала позволяют наблюдать за направлением потока лучей при работе облучателя. Специальные шторки разделяют зону на четыре сектора, что удобно для пациентов.

Комплектность аппарата ОУФну (УГН-1) при поставке:

  • облучатель в собранном виде (без тубусов, кронштейнов и шторок),
  • тубус для рта — 4 шт.,
  • тубус для носа — 4 шт.,
  • тубус для миндалин — 4 шт.,
  • заглушка (колпачек) на место тубуса — 4 шт.,
  • кронштейн для крепления шторок — 4 шт.,
  • шторка тканевая — 4 шт.,
  • инструкция по эксплуатации 82-00-00РЭ (ниже её можно скачать с нашего сайта),
  • вставка плавкая (предохранитель) ВП2Б-1-6,3А — 2 шт.

Ультрафиолетовые лучи биологически весьма активны и при неумелом использовании облучателя ОУФну (УГН-1) могут причинить пациенту серьезный вред. Поэтому медперсонал должен обслуживать пациентов только по врачебному предписанию с точным указанием дозировки.

При длительной работе облучателя ОУФну может ощущаться характерный запах озона. В этом случае рекомендуется выключить аппарат и проветрить помещение.

  Через каждые два часа непрерывной работы необходимо выключать облучатель ОУФну на 20–30 минут. На время перерыва, не превышающего 30 минут, аппарат выключать не рекомендуется, так как повторное зажигание возможно только после охлаждения лампы ДРТ-240.

Облучатель ОУФну(УГН-1)

Название:

Артикул:

Текст:

Выберите категорию:
Все СТОМАТОЛОГИЯ » Каталоги производителей » ТОВАР НЕДЕЛИ в МАКСИДЕНТ » АКЦИИ для СТОМАТОЛОГОВ / 100 АКЦИЙ от МАКСИДЕНТ » Комплекты оборудования по спец ценам » НОВИНКИ сайта МАКСИДЕНТ » Товары с ограниченным сроком годности » Ортодонтия » Стоматологические материалы »» Адгезивы и Бондинги »» Артикуляционная бумага и спрей »» Вспомогательные средства »» Гели протравки »» Детская стоматология »» Защитные средства »» Костные материалы / Остеопластические материалы »» Клампы и Бринкеры,Рамки,Щипцы,Пробойник, »» Коффердам , Раббердам , Клампы »» Лечебные препараты »» Лицевые дуги,артикуляторы,аппараты для определения окклюзии »» Матрицы,клинья,штрипсы »» Материал для восстановления культи зуба »» Насадки смешивающие,пистолеты »» Одноразовые средства »»» Бахилы »»» Валики »»» Маски и респираторы »»» Полотенца »»» Простыни »»» Перчатки »»» Салфетки,фартуки »»» Пылесосы »»» Слюноотсосы »»» Чехлы »»» Стерильные изделия »»» Халаты »» Ортопедия »»» Материалы для фиксации »»» Слепочные материалы »»» Материалы для ремонта керамики »»» Материалы для временных коронок »»» Материалы для регистрации прикуса »»» Пластмассы »»» Материалы для восстановления культи »» Отбеливание »» Пломбировочные материалы »»» Пломбировочные материалы наборы »»» Пломбировочные материалы(не в наборах) »» Полировка »» Профилактика »» Пластины, пленки и заготовки полимерные для термоформирования »» Ретракция десны »» Трейнеры,капы для зубов »» Хирургия »»» Костные материалы »»» Щипцы »»» Элеваторы »»» Люксаторы DIRECTA »»» Люксаторы »»» Инструменты костные »» Шинирование »» Штифты эндоканальные »» Шовный материал »» Эндодонтия » Имплантологам »» Имплантаты »»» Имплантационная система MIS »»» Имплантационная система Anthogyr Франция »»» Имплантационная система Hi-Tec (ХайТек) »» Инструменты для имплантологии »»» Инструменты для имплантологии HLW Германия »»» Инструменты других производителей »» Зеркала для фотографирования »» Костные материалы »» Шовный материал » Инструменты »» Боры,подставки для боров »» Гладилки и штопферы »» Диски,фрезы »» Долота,остеотомы »» Иглодержатели »» Инструмент для работы с коронками »» Инструменты для терапии »» Зажимы,корцанги,цапки для белья »» Зеркала и ручки для зеркал »» Зеркала для фотографирования »» Зонды, плаггеры, спредеры, эксплореры »» Крючки хирургические »» Коронкосниматели,мотосниматели »» Кусачки костные »» Кюреты и скейлеры пародонтологические »» Лезвия для скальпелей »» Лотки для инструмента »» Ложки костные »» Ложки кюретажные »» Ложки слепочные »» Люксаторы DIRECTA »» Люксаторы »» Молотки, долота, остеотомы »» Наборы для трахеотомии »» Ножницы хирургические прямые и изогнутые »» Пинцеты стоматологические,хирургические,анатомические »» Распаторы »» Ретракторы и роторасширители »» Ручки для скальпелей »» ФАБРИ инструменты »» Щипцы »» Шприцы карпульные,интралигаментарные и иглы »» Шпатели »» Элеваторы »» Экскаваторы »» Прочие инструменты для стоматологов и техников »» Экрадент Стоматологические ИНСТРУМЕНТЫ » Дезинфекция и Стерилизация »» Дезсредства »» Журналы и книги учета »» Контейнеры для дезинфекции »» Контроль стерилизации / Индикаторы »»» Индикаторы химические »»» Индикаторы биологические »» Контроль дезинфекции »»» Контроль паровоздушной дезинфекции »» Контроль условий хранения и транспортирования МИБП »» Контроль продуктов питания »» Коробки стерилизационные »» Определение кислотности растворов/рН »» Предстерилизационная очистка » Рентгензащита » ОБОРУДОВАНИЕ »» 3D сканеры и CAD/CAM системы »» Автоклавы »» Амальгамосмесители »» Аппараты для диагностики и дезинфекции »» Аппарат для смазки и чистки наконечников »» Аппарат для заполнения корневых каналов зуба разогретой гуттаперчей »» Аппараты для диагностики кариеса »» Аппараты общего назначения »» Аппараты пескоструйные »» Аппараты ультразвуковые,скалеры,насадки »» Аппараты хирургические »» Апекслокаторы »» Аспирационные системы и помпы »» Бинокуляры и лупы »» Бормашины зуботехнические,Микромоторы »» Встраиваемое оборудование »»» Моторы щеточные (коллекторные) »»» Моторы безщеточные (коллекторные) »»» БЛОКИ УПРАВЛЕНИЯ КОЛЛЕКТОРНЫМИ микроэлектродвигателями (комплект в установку) »»» БЛОКИ УПРАВЛЕНИЯ КОЛЛЕКТОРНЫМИ микроэлектродвигателями(комплект в установку) »»» Разное встраив. оборудование »» Гелиолампы,Лампы полимеризационные »» Гипсоотстойники »» Дефибрилляторы »» Диатермокоагуляторы »» Дистилляторы,деминерализаторы »» Запасные части к оборудованию »» Интраоральные камеры »» Ирригаторы и щетки »» Кабели,загубники,насадки и прочее »» Камеры для стерилизации »» Компрессоры »» Кресло стоматологическое »» Лазеры »» Лампы для отбеливания »» Микроскопы »» Моюще-дезинфицирующие аппараты »» Наконечники,микромоторы,переходники »»» Наконечники,микромоторы,переходники »»» Наконечники прямые »»» Спрей для наконечников,смазки »» Негатоскопы »» Облучатели,рециркуляторы »» Обтурация канала »» Ортопантомографы »» Ортодонтическое оборудование »» Параллелометр »» Печь для разогрева композита »» Реанимационное оборудование для стоматологии »» Рентгеновское оборудование »»» Портативные рентген аппараты »»» Радиовизиографы »»» Дентальные рентген аппараты »»» Панорамные рентген аппараты »»» Сканеры рентгенографических пластин и Проявочные машины »»» Разное для рентгенологии »» Светильники,осветители стоматологические »» Система SAF »» Скалеры / Скейлеры ,насадки и наконечники к ним »»» Насадки для скалера »» Стерилизаторы / Сухожары »» Стулья стоматологические »» Тележки универсальные »» Ультразвуковые ванны/Мойки ультразвуковые/Ванночки/ »» Упаковочные машины »» Установки стоматологические »» Утилизаторы и Деструкторы игл »» Физиотерапевтические аппараты для стоматологии »» Физиодиспенсеры »» Холодильники фармацевтические »» ЭЛЕКТРООДОНТОДИАГНОСТИКА,Электроодонтотестеры,Электроодонтометр »» Эндомоторы »» ElectronicBite-система подсветки » Зуботехнические материалы,инструменты и оборудование »» Расходные материалы для лабораторий »»» Воска »»» Гипсы »»» Десневые маски »»» Диски,полиры, фильцы »»» Зубы пластмассовые »»» Кисти, палитры »»» Керамика »»» Клей, лаки,разделительные,изоляционные средства »»» КРУГИ прорезные,шлифовальные »»» Материалы для изготовления коронок »»» Пластмассы зуботехнические »»» Cиликон для дублирования »»» Сплавы »»» Паковочные массы »»» Прочие Материалы для техников »» Артикуляторы и окклюдаторы и лицевые дуги »» Блок с микромотором встраиваемый в стом. установку »» Боксы,вытяжки для зуботехнической лаборатории »» Вакуумформеры »» Вакуумные смесители »» Весы »» Вибростолики »» Воскотопки »» Гипсоотстойники »» Горелки газовые и спиртовые »» Зуботехнические прессы »» Инструменты для техников »» ИНСТРУМЕНТЫ И ОБОРУДОВАНИЕ ДЛЯ РАБОТЫ С ВОСКОМ »» Комбинированные устройства »» Лабораторные столы »» Литейные установки,все для литейной лаборатории »» Материалы для CAD/CAM-системы »» Мебель для зуботехнической лаборатории »»» Стул зубного техника »» Микромоторы,Бормашины зуботехнические »»» Микромоторы высокой мощности (до 230 Ватт) безщёточные бормашины »»» Микромоторы обычной мощности (до 40 Ватт) бормашины »»» Микромоторы повышенной мощности (до 100 Ватт) щёточные бормашины »» Муфельные печи »» Наконечники »»» Наконечники-микромоторы бесщёточные »»» Наконечники-микромоторы щёточные »» Оборудование для изготовления моделей »» Отсасывающие системы »» Пайка Сварка »» Параллелометр »» Пароструйные аппараты »» Педали включения / выключения »» Педали плавного регулирования »» Переходники »» Пескоструйные аппараты »» Печи для обжига металлокерамики »» Печи Электромуфельные и Сушильные »» Полимеризаторы »» Рабочее место шлифовки и полировки (СТОИМОСТЬ ШЛИФМОТОРА ЗАВИСИТ ОТ ЦЕНЫ ПОСТАВЩИКА И В ЦЕНУ ПРАЙСА »» Система изготовления зубных протезов методом гальванопластики AGC »» Триммеры »» ТЕХНИКА ТЕРМОФОРМИРОВАНИЯ »» Устройства нагрева »» Фрезера,сверлильные станки »» Шлифмотор и принадлежности »» Электрошпатели »» Товары для 3D печати » Мебель »» Стулья »» Мебель металлическая »» Мебель из ЛДСП »»» Столы, надстройки, тумбы из ЛДСП »»» Шкафы, стеллажи, антресоли »»» Кушетки из ЛДСП »» Ширмы, тележки, прочее »» Кушетки массажные и принадлежности »» Мебель для зуботехнической лаборатории »»» Столы гипсовочные »»» Столы зубного техника / Столы зуботехнические » Книги / Литература / Библиотека / Стом. издания / Медкнига / Стоматология Специальная медицина / Ме » Для студентов стоматологов » Товары общего назначения »» Демонстрационные модели »» Разное »» Все для офиса,склада и дома »» Вспомогательные средства »» Аптечки разные » Запчасти к оборудованию МЕДИЦИНА и КОСМЕТОЛОГИЯ » АКЦИИ для медцентров » Расходные материалы и инструменты »» Аптечки »» Бумажная продукция »»» Пакеты гигиенические »»» Покрытие на унитаз »»» Полотенца для рук »»» Полотенца для уборки »»» Простыни »»» Салфетки для лица »»» Салфетки для протирания »»» Салфетки для рук »»» Салфетки цветные »»» Туалетная бумага »» Бумага регистрационная,электроды,мундштуки,загубники,кабели »»» Для анализатора »»» Для УЗИ »»» Для ФМ »»» Для ЭКГ »»» Для ЭЭГ »»» Кабели,электроды »»» Прочее »» Бумага регистрационная »» Инструменты мц »»» Гинекологические зеркала и наборы »»» Емкости для стерилизации »»» Емкости прочие »»» Зажимы,корцанги,цапки для белья »»» Зеркала »»» Зонды »»» Иглы »»»» Акупунктурные »»»» Биопсийные »»»» для Мезотерапии »»»» Игла-бабочка »»»» Инъекционные »»»» Ланцеты »»»» Спинальная »»»» Хирургические »»» Иглодержатели »»» Кюретки »»» Лезвия для скальпелей »»» Лотки и маты »»» Ножницы,ножи »»» Пинцеты »»» Прочие инструменты »»» Распаторы »»» Ручки для скальпелей »»» Скарификаторы »»» Скальпели и Лезвия »»» мундштуки »»» загубники »»» кабели »»» Зажимы »»» корцанги »»» цапки для белья »»» Катетеры »»» Ножницы »»» ножи »»» Шприцы »» Изделия из резины, силикона, латекса »» Лаборатория »»» Дозаторы и наконечники »»» Изделия из резины, силикона, латекса »»» Контейнеры »»» Пробирки вакуумные »»» Пробирки лабораторные – пластик »»» Пробирки цилиндрические(стекло/пластик) »»» Пробирки лабораторные – стекло »»» Пробирки Моноветт »»» Пробирки центрифужные – стекло »»» Прочее »»» Пробирки центрифужные – пластик »»» Пробирки вакуумные Вакутайнер »»» Реагенты для гем. анализаторов »»» Реактивы для лабораторных исследований »»» Стекло »»» Штативы »» Одноразовые средства »»» Бахилы »»» Воротнички »»» Головные уборы »»» Защита глаз »»» Коврики »»» Коврики »»» Комплекты одежды для процедур нестерильные »»» Комплекты одежды для процедур стерильные »»» Маски одноразовые и респираторы »»» Носки »»» Одежда для процедур »»» Пеньюары »»» Перчатки »»»» Держатели для перчаток »»»» Нестерильные перчатки »»»»» Виниловые »»»»» Нитриловые »»»»» Прочие перчатки »»»»» Смотровые »»»»» Хирургические »»»» Стерильные перчатки »»»»» Нитриловые стерильные »»»»» Прочие стерильные перчатки »»»»» Нитриловые стерильные »»»»» Смотровые стерильные перчатки »»»»» Хирургические стерильные перчатки »»» Полотенца »»» Простыни »»»» Простыни нестерильные »»»» Простыни стерильные »»» Разделители пальцев »»» Салфетки и фартуки »»» Трусы »»» Чехлы »»» Фольга »»» Халаты »»» Фартуки »»» Тапочки »»» Шапочки »» Перевязка »»» Салфетки ранозаживляющие »»» Салфетки инъекционные »»» Марля »»» Клеенка »»» Вата стерильная и нестерильная »»» Пластырь бактерицидный »»» Пластырь фиксирующий »»» Салфетки для перевязки »»» Бинты нестерильные »»» Бинты стерильные »»» Бинты гипсовые »»» Бинты трубчатые »» Продукция по уходу за ребенком »» Пленка и Химия »»» Пленка для Маммографии »»» Пленка зеленая »»» Пленка синяя »»» Прочее Пленки и Химия »» Прочее (расходники) »»» Коврики антибактериальные »»» Мочеприемники »»» Мундштуки »»» Освежители воздуха TORK »»» Трубки и воздуховоды »»» Разное (расходники) »» Расходный материал для оборудования »» разное (расходники) »» Средства гигиены »» Тесты »»» Тест-полоки на мочу »»» Прочие тест-полоски »»» Тесты дыхания на алкоголь »»» Тест-полоски на дезинфицирующие средства »»» Тест-полоски на кровь »» Фартуки нестерильные »» Уборочный инвентарь »»» Аксессуары »»» Тряпки,Салфетки »»» Тележки »»» МОП »» Упаковочный материал »»» Бумага крепированная »»» Бумага креповая »»» Бумага оберточная »»» Лента индикаторная »»» Пакеты (сумки) пылевлагозащитные »»» Пакеты бумажные »»» Пакеты ВЛАГОПРОЧНЫЕ »»» Пакеты КРАФТ/Крафт-пакеты »»» Пакеты КРАФТ ГЕКОМЕД »»» Пакеты объемные бумага/пленка »»» Пакеты плоские простые бумага/пленка »»» Пакеты плоские самозапечатывающие бумага/пленка »»» Пакеты с замком »»» Пакеты усиленные (бумага/пленка) »»» Рулоны объемные »»» Рулоны плоские »» Утилизация »»» Емкости класса А »»» Емкости класса Б »»» Контейнеры класса Б »»» Корзины для мусора »»» Мешки класс А »»» Мешки класса Б »»» Мешки класса В »»» Мешки класса Г »»» Прочее(Утилизация) »»» Тележки (Утилизация) »» Гели »» Шовный материал »» Система для растворов »» Дезинсекция » Стерилизация и Дезинфекция »» Дезинфицирующие средства »» Дезинфекция и гигиена кожи и рук »» Дезсредства для дезинфицирующих и моющих машин »» Дозатор локтевой »» Журналы и книги учета »» Емкости класса В »» Индикаторы »»» Биологические индикаторы »»» Дезиконты »»» Журналы регистрации »»» Интесты »»» Медисы »»» Прочие »»» Стериконты »»» Стеритесты »»» Фарматесты »» Контейнеры для дезинфекции »» Камеры дезинфекционные »» Комплект для раздачи лекарств »» Коробки стерилизационные »» Лампочки бактерицидные »» Моюще-дезинфицирующие аппараты »» Оборудование для приготовления дезрастворов »» Облучатель-рециркуляторы бактерицидные »» Обеззараживания медицинских отходов »» Стерилизаторы воздушные »» Стерилизаторы паровые »» Стерилизаторы воздушные с охлаждением »» Тест – полоски »» Ультразвуковая моечная установка »» Утилизация медицинских отходов »» Устройства термосваривающие упаковочные »» Чистящие и моющие средства »» Шкаф для сушки и хранения медицинских изделий »» Шкафы суховоздушные » Оборудование для клиник и учреждений »» Оборудование СБОР клиникам »» Автоклавы »» Аквадистилляторы »» Акушерство и гинекология »» Аппараты для педикюра со встроенным пылесосом »» Аппараты сшивающие хирургические »» Аппараты общего назначения »» Аппараты УЗИ и сканеры »» Аппараты а-ивл/влил, ингаляционного наркоза анпсп »» Вакуумные массажеры »» Весы »» Внутрикостные пистолеты »» Водяные бани »» Гинекологическое оборудование »» Диагностическое оборудование »» Дефибрилляторы »» Дерматовенерологическое Оборудование »» Дозаторы шприцевые и насосы инфузионные »» Закаточное оборудование »» Измерительные приборы »»» Гигрометры »»» Доп. устройства для дезсредств »»» Прочее / измерит. приборы »»» Секундомеры »»» Весы »»» Термометры »»»» Термометры ртутные и безртутные »»»» Термометры инфракрасные »»»» Термометры электронные »»» Тонометры »»»» Тонометры автоматические »»»» Тонометры механические »»»» Тонометры полуавтоматические »»»» Манжеты для тономеров »» Кардиологическое оборудование »» Камеры для стерилизации »» Камертоны »» Кольпоскопы »» Коагуляторы »» Косметологическое оборудование »» Кислородное оборудование »» Кресла инвалидные »» Криотехника »» Лабораторное оборудование »»» Анализаторы »»»» Экспресс-анализаторы »»» Встряхиватели »»» Лабораторное оборудование НВ »»» Прочее лабораторное оборудование »»» Термостаты,встряхиватели,шейкеры »»» Центрифуги »» Лампы »» Логопедический кабинет / Кабинет логопеда »» ЛОР оборудование »»» Ларингоскопы »»»» Продукция фирмы KaWe (Германия) »»»»» Рукояти »»»»» Клинки изогутые »»»»» Клинки прямые »»»»» Доп.Опции »»»»» Ларингоскопы для трудной интубации »»» ЛОР оборудование »» Лупы и Бинокуляры »» Массажное оборудование »» Матрацы и подушки противопролежневые »» Маникюрное оборудование »» Микроскопы »» Мониторы прикроватные »» Нагревательные плиты »» Неврология »» Неонатология »» Негатоскопы »» Оборудование разное »» Реабилитационное Оборудование »»» Костыли,трости,ходунки »»» Кресла-коляски инвалидные »»» Матрацы и подушки противопролежневые »»» Столики прикроватные »» Оборудование для медкабинета в школе »» Облучатели,рециркуляторы »» Операционные столы »» Отоскопы »»» Отоскопы лампочные »»» Отоскопы с фиброооптикой »» Отсасыватели »» Офтальмологическое оборудование »» Парикмахерское оборудование »» Педикюрное оборудование »» Пульсоксиметры »» Реанимационное оборудование для клиник »»» Дозаторы и насосы »»» Шприцевые дозаторы-инфузионные насосы »»» Мониторы »» Рентген »» Ростомеры »» Стерилизаторы / Сухожары »» Светильники медицинские »» СПА SPA-оборудование »» Стерилизаторы »» Тележка-каталка, приемное устройство для скорой помощи »» Тележки универсальные »» Ультрафиолетовые лампы »» Ультразвуковые ванны/Мойки ультразвуковые/Ванночки/ »» Урологическое оборудование »» Упаковочные машины,Запечатывающие машины »» Утилизаторы и Деструкторы игл »» Центрифуги »» Физиотерапевтическое Оборудование »»» Электромагнитные поля »»» Ультразвуковая терапия »»» Лазерная терапия »»» Магнитотерапия »»» Прочее физиотерапевтическое оборудование »»» Электрические токи »»» Ингаляторы »»» Теплолечение »»» Светолечение »»» для массажа аппараты »»» Распылители »» Фетальные допплеры »» Фонендоскопы,стетоскопы,тонометры,Динамометры »» Холодильники фармацевтические »» Школа.Медицинский кабинет в школе »» Электроды »» Эндоскопия и лапароскопия Оборудование » Все для парикмахерских и салонов красоты »» Расходники для парикмахерских »»» Аксессуары для парикмахерских »»» Коврики »»» Носки »»» Тапочки »»» Средства для волос »»» Одежда для процедур »»» Комплекты для процедур »»» Коврики »»» Защита глаз »»» Головные уборы »»» Воротнички »»» Бахилы »»» Салфетки »»» Фартуки »»» Халаты »»» Фольга »»» Чехлы »»» Трусы »»» Разделители пальцев »»» Простыни »»» Полотенца »»» Перчатки »»» Пеньюары »» Оборудование Парикмахерское »»» Кресла Парикмахерские »»» Мойки Парикмахерские »» Маникюрные инструменты »» Принадлежности для депиляции »» Парафинотерапия »» для СПА, массажа и сауны »» Для солярия »» Для маникюра и педикюра »» Для косметологии и визажа »» Для восковой депиляции » Мебель »» Мебель металлическая »» Мебель металлическая для клиник »» Ширмы, тележки, прочее »» Мебель из ЛДСП »»» Столы, надстройки, тумбы из ЛДСП »»» Шкафы, стеллажи, антресоли »»» Кушетки из ЛДСП »» Кушетки массажные »»» Стационарные кушетки »» Мебель Диакомс Россия »»» Массажные комплекты »»» Столики медицинские »»» Шкафы медицинские »»» Тележки »»» Столы перевязочные »»» Кресла массажные »»» Кресла гинекологические »»» Кровати акушерские »»» Кровати медицинские »»» Штативы медицинские »»» Банкетки »»» Антресоли »»» Кресла донорские »»» Ширмы »»» Ростомеры,весы »»» Разное »» Штативы медицинские »» Кровати »» Кушетки »» Прочая мебель »» Столы »» Стулья »» Тумбы »» Шкафы »» Мебель для акушерства и гинекологии » Рентгензащита и оборудование » Все для офиса,склада и дома » Разное . ЛИЦЕНЗИРОВАНИЕ КЛИНИК » Лицензирование клиники-что это? и какие этапы вас ожидают ? » Стандарты оснащения клиник -Стоматология,Зуботехническая лаборатория » для Лицензирования клиник / медцентры / салоны красоты / парикмахерских АРЕНДА ОБОРУДОВАНИЯ ДЛЯ ЛИЦЕНЗИРОВАНИЯ КРАСОТА и ЗДОРОВЬЕ » Asiakiss-косметические маски » Уход за зубами »» Отбеливание домашнее »» Трейнеры,капы для зубов »» Ирригаторы и щетки » Уход за лицом » Уход за телом »» Средства от запаха и пота » Уход за волосами » Для визажа » Для солярия » Разное .. ВЕТЕРЕНАРИЯ » Оборудование для ветеринарных клиник »» Анестезиологическое оборудование »» Ветеринарные мониторы пациента »» Ветеринарные электрокардиографы »» Ветеринарные столы для УЗИ и кардио процедур »» Ветеринарные УЗИ сканеры »» Ветеринарные отоскопы, стетоскопы и тонометры »» Весы ветеринарные »» Дезинфекция и стерилизация »» Кислородные концентраторы »» Лампа Вуда »» Носилки-тележки для перемещения животных »» Намордники и сумки для обследования животных »» Оборудование для фиксации животного и термолежаки »» Рентген оборудование для ветеринарии »» Светильники хирургические »» Столы для крупных животных »» Столы хирургические ветеринарные »» Станки ветеринарные операционные »» Стоматологическое оборудование для ветеринарии »»» Скалеры ультразвуковые ветеринарные »»» Портативные стоматологические установки »»» Рентген стоматологический »»» Инструмент для ветеринарии стоматологический »» Термометры »» Физиотерапевтические аппараты для животных »» Холодильное оборудование »» Шприцевые дозаторы и деструкторы игл »» Электрокоагуляторы »» Эндоскопическое оборудование » Ветеринария АРЕНДА выставочного оборудования Все для офиса,склада и дома » Создание сайта для клиник от МАКСИДЕНТ » Бахилы » Перчатки » Товары общего назначения » Оборудование для офиса ПОДАРКИ и СУВЕНИРЫ » Пано и Фигурки из керамики Продажа б/у оборудования для медицины и стоматологии Пломбировочные материалы и цементы

Производитель:
Все3A MEDES (Корея)3M ESPE3M Unitek США3Shape ДанияAALBA DENT INC. СШАAB Ardent ШвецияAdvanced Sterilization ProductsAGILE industriesAitecsAjax (Китай)AmannGirrbachAmazing White СШАAmtech ВеликобританияANDERS DENTALAngelus БразилияAnsell Medical МалайзияAntaeosAnthogyr (Франция)Anthogyr ФранцияAnthos ИталияApexmed Апексмед Интернэшнл Б.В. / НидерландыApoza ТайваньAquajetAquapick КореяARDent, ШвецияARIA di ODONTOIATRIA S.r.l. (Италия)ArkonaARKONA АрконаArtiglio (Италия)Asa Dental S.p.a.Asa Dental ИталияAsiakiss КореяAspinaB.Braun ГерманияBambach АвстралияBaolai Medical КитайBaush ГерманияBayer ГерманияBego ГЕРМАНИЯBenovy МалайзияBeromed GmbH Hospital Products Германия (т.м. “BEROCAN”)Beyond СШАBien-Air ШвейцарияBINDERBionetBisco СШАBisicoBJM LAB ИзраильBK Giulini ГерманияBlossom МалайзияBMT (Чехия)Borer ШвейцарияC.E.J. Dental (США)CandulorCardiolineCARL ZEISS (Германия)Carlo De Giorgi ИталияCastellini, ИталияCattani (Италия)Cattani ИталияCDG КитайChemische Fabrik Dr. Weigert GmbH & Co. KG (Германия)Chirana Medical СловакияColtene ШвейцарияColumbia Dentoform СШАCominox ИталияCOSSHINYF EnamelCoswell SPACovidien СШАCOXO Medical Instrument Co., Lt КитайCrosstex СШАCSN ИталияD-Tec, ШвецияDaiei Dental (Япония)DARTA РоссияDeepak СШАDeguDent (Германия)DENKEN KDF (Япония)Densim СловакияDenstar (Корея)Dental TechnologiesDental X ИталияDentalfilm ИталияDentalHiTecDentamerica Inc.Dentech Corporation, ЯпонияDENTKIST Южная КореяDentLight СШАDentsply (США)Dentsply Maillefer SironaDentstar АнглияDentstar, Южная КореяDeppeler ШвейцарияDERMAGRIP МалайзияDetax ГерманияDetes КитайDexcowin КореяDexisDezodent (Германия)DiaDentDiamondbrite (США – Мексика)DigiMed Ю. КореяDigiMed Южная КореяDiplomat Dental (Словакия)Discom КитайDiscus DentalDispodent КитайDispodent КореяDMETEC КореяDMG ГерманияDonfeelDr. Hinz DentalDr. Schumacher GmbH ГерманияDreve Dentamid GmbHDSLightPost РоссияDURR Dental AG ГерманияDynaFlexEASTRICH (Тайвань)Eastrich Enterprise (Тайвань)Edan InstrumentsEdarredo (Италия)EdelweissEdenta ШвейцарияEKOM СловакияElma ГерманияElma, ГерманияEluan JYK, КитайEMS ШвейцарияEnamel ИталияEschenbach ГерманияEschenbach Германияchenbach ГерманияEuro Type КитайEuronda ИталияEVE ГерманияFaro ИталияFengdan КитайFGM БразилияFimet ФинляндияFONA Dental s.r.o. СШАFONA ИталияFONA КитайForum ИзраильGC ЯпонияGC ЯпонияGeistlich Pharma AGGelato (США)Gendex ГерманияGendex СШАGenie ИталияGenoray КореяGERMIPHENE CORPORATIONGILIGA (Тайвань)GlasSpanGold MillGood Doctors КореяH. Nordin ШвейцарияH.Nordin (Швейцария)H.Nordin ШвейцарияHager & Werken ГерманияHager Werken ГерманияHaier (Китай)Hallim КитайHapicaHarald NordinHEINE ГерманияHeliomed Handelsges.m.b.H, АвстрияHELM-PLAINHigenic ШвейцарияHLW ГерманияHM КитайHong Ke, КитайHoricoHRS КореяHu-FriedyHUM GmbH, ГерманияHumanChemieHumanChemie ГерманияHumanray КореяI.C. Lerсher ГерманияIcanClave КитайINTEGRAL MedicalINTEGRAL Medical Китай (т.м. “INTEGRAL”)InterdentItena ФранцияITERUM-Dental Implants&Equipment LTD (Израиль)Ivoclar Vivadent AG ЛихтенштейнJ. Morita ЯпонияJNB КитайJonson&JonsonJotaKAGAYAKIKaVo (Германия)KaVo ГерманияKaweKD Medical GMBH ГерманияKENDA ЛихтенштейнKerr Hawe СШАKeystone IndustriesKeystone СШАKodak Dental SystemsKohler Medizintechnik ГерманияKomet® ГерманияKulzer ГерманияKuraray Noritake ЯпонияKWI (Тайвань)LAMBDA S.p.A., ИталияLascod ИталияLegrin КитайLeica ГерманияLEIKOLeoneLerсher ГерманияLIXIN Jiangyin Diamond ToolsLM ФинляндияLuerLuxsutures (Люксембург)M. SCHILLING GmbH ГерманияMagic ИталияMagnolia CattaniMajor (Италия)Major ИталияMani ЯпонияMATECH (США)MDT ИзраильMEDERENMedicNRG ИзраильMegadenta ГерманияMegasonex, СШАMeisinger ГерманияMELAG ГерманияMEMMERTMercury (Китай)META Biomed КореяMetraxMGF ИталияMICERIUMMicro Mega ФранцияMicroNX КореяMilestone Scientific (США)MindrayMiradentMIS ИзраильMitsubishi ЯпонияMobilico КитайMOCOM ИталияMonitex ТайваньMr.Curette (МСТ), Южная КореяMRCMuller-Omicron (Германия)Muller-Omicron ГерманияMVS In Motion (Бельгия)MyRay ИталияNAIS БолгарияNanning Baolai КитайNew Life RadiologyNewmed S.r.l. ИталияNICNIHONSHIKA KINZOKU (Япония)NiksyNiksy КитайNINGBO HI-TECH UNICMED IMP&EXP CO, LTD, КитайNipro КореяNissin ЯпонияNopa instruments, ГерманияNordiska DentalNoritake ЯпонияNSK Nakanishi Inc. ЯпонияOlidentOMEC (Италия)Omec, ИталияOMNIDENT ГерманияOMS ИталияOp-d-op СШАOrangedentalOrangedental ГерманияOrangeinstrumentsOrascoptic/Surgical Acuity d/b/aOrix HF ИталияOrmco СШАOro Clean Chemie ШвейцарияOrtho-TainOwandy s.a.s. ФранцияP&T Medical (Китай)P&T Medical КитайPanasonicParkell, СШАPaul Hartmann ГерманияPD ШвейцарияPhilipsPhilips НидерландыPHYSIO CONTROLPi dental (Венгрия)Pierrot ИспанияPlanmeca Oy ФинляндияPoliTec, ГерманияPoly Medicure Limited Индия (т.м. “POLYFLON FEP”)Polydentia ШвейцарияPolywaxPOSDION (Ю. Корея)Poskom КореяPremier СШАPresiDENTPresident Dental GmbHPrime-Dent СШАProCare МалайзияProgeny СШАPROMISEE DENTAL (Китай)R-TestReDent Nova (Израиль)Redent Nova ИзраильRemeza (Белоруссия)Renfert ГерманияRESORBA ГерманияRiester GmbH ГерманияRoder DentalinstrumenteRoeko ГерманияRonvigRoson Medical Instruments КитайRTDRUNYESS-Denti (Ю. Корея)Sabana ГерманияSaeshin Ю. КореяSaeyang Microtech CO., LTD, Южная КореяSAFSafe&Care МалайзияSalli (Финляндия)Sapphire ГерманияSarstedt AG, ГерманияSatelec Sas Acteon Group Division ФранцияScheftner ГерманияScheu Dental ГерманияSCHICK DENTAL ГерманияSchick Technologies Inc. СШАSchiller ШвейцарияSCHULER, ГерманияSchulke & Mayr ГерманияSchutz ГерманияSchwert ГерманияSciCan (Канада)SDI ШвецияSDS ТайваньSecaSempercare МалайзияSeptodont ФранцияSF Medical Products GmbH ГерманияSFM Hospital ProductsSHANGHAI SHEEN MEDICAL INSTRUMENT Co..,LtdSherbetShine АвстрияSHINING 3DShofu ЯпонияSiger КитайSilfradent (Италия)SironaSirona Dentsply Maillefer SironaSLASHSMT(Корея)Soderex ФинляндияSoltec ИталияSONG YOUNG (Тайвань)Song Young ТайваньSonotraxSony Corporanion ЯпонияSpident КореяSpofaDental KerrSS White СШАSteelco ИталияStern Weber (Италия)Stomadent SK СловакияSultanSuni Imaging Microsystems,Inc. СШАSunViv МалайзияSure Cord КореяSURU International Pvt. Ltd. Индия (т.м. “SURUWAY”)Suzhou Zhen Wu Medical Sutures & Suture Needles Factory КитайSwiDella КитайSybronEndo (США)Tau Steril ИталияTau Steril, ИталияTechnodent, АргентинаTecno-Gaz (Италия)TePeTokuyama Dental ЯпонияTork ШвецияTroge Medical GmbH ГерманияTuttnauer Company LTD ИзраильUgin (Франция)ULABUltradent СШАVatech Ю.КореяVDW ГерманияVeranaVERICOM КореяVERIDENTVita (Германия)Vita, ГерманияVoco ГерманияVogt Medical GmbH ГерманияVRK LabW&H DentalWerk АвстрияWaismed-PerSysMedicalWaterpikWebCamera КитайWelch AllynСШАWerther S.P.AWerther ИталияWiedoo (Китай)Wieland (Германия)Wieland, ГерманияWoodpecker DTE КитайWoodpecker КитайWoson КитайWu Wei КитайWuerWei КитайWuerWei, КитайYDM ЯпонияYeti (Германия)Yeti, ГерманияYMARDA КитайYOUJOY КитайYuyao Jintai Machine Factory (Китай)ZEISS ГерманияZeitun ИорданияZhermack ИталияZhermapoZollАванта РоссияАверон (Россия)Аверон РоссияАгри КазаньАксионАксион РоссияАльтонАРМЕДАэролайф (Россия)БелоруссияБиоссБозон РоссияБразилияВалентаВеликобританияВита-Пул РоссияВладМиВаВладмива (Россия)ВладМиВа РоссияВоко Voco ГерманияВормаВоронеж ДентисГеософт ДентГерманияГигиена Мед РоссияДанияДента-М, Струм БелоруссияДентсплай DentsplyДжи Си GC ЯпонияДиакомс РоссияЕлатомский ПЗ, ЕлатьмаЕлатомский ПЗ,ЕлатьмаЖасмин-МедИвокляр IvoclarИзраильИкадент РоссияИндияИнститут развития инновационной стоматологииИнтермедапатит РоссияИспанияИталияИтена Itena ФранцияКазаньКазань КМИЗКанадаКасимовский Приборный Завод (Россия)КитайКореяКристи РоссияКристидент РоссияКронт РоссияЛатвияМedical ECONETМалайзияМалайзия Karex Industries SDN BHDМедполимер РоссияМексикаМЕТА КореяМИЗ-Ворсма (Россия)Можайский МИЗ РоссияМониторНавтекс РоссияНидерландыНидерланды Rovers Medical Devices B.VОмега-Дент РоссияОрганик Фармасьютикалз ОООПакистанПозис РоссияПолистом РоссияПольшаРадуга РоссииРазноеРоссииРоссияРоссия ЭкрадентРоссия-Израиль-ГеософтСербияСерпухов «ВХ-Тайфун»Сибмединструмент РоссияСканерСловакияСмоленское СКТБ СПУ (Россия)Сонис РоссияСпектрум Интернэшнл, Инк., СШАСтомаСтома (Украина)Стома УкраинаСтома ХарьковСтомадент РоссияСтомахимСтрумСШАТайваньТайвань ROLENCEТехноДент РоссияТЗМОИТМТТор ВМТОР ВМ РоссияУкраинаФинляндияФорма Углич РоссияФранцияЦелит ВоронежШвейцарияШульц Германия Mani SchutzЭстэйд-Сервисгруп РоссияЮжная КореяЮЮ МедикалЮЮ Медикал КитайЯпония

Новинка:
Вседанет

Спецпредложение:
Вседанет

Результатов на странице: 5203550658095

Найти

Химиолучевая терапия с расширенным облучением узлов и/или эрлотинибом при местнораспространенном плоскоклеточном раке пищевода: долгосрочное обновление данных рандомизированного исследования фазы 3

  • 1.

    Torre, LA, Bray, F., Siegel, RL, Ferlay, J. , Lortet-Tieulent, J. & Jemal, A. Глобальная статистика рака, 2012. CA Cancer J. Clin. 65 , 87–108 (2015).

    Google Scholar

  • 2.

    Купер, Дж. С., Го, М. Д., Herskovic, A., Macdonald, J.S., Martenson, J.A., Jr., Al-Sarraf, M. et al. Химиолучевая терапия местнораспространенного рака пищевода: долгосрочное наблюдение проспективного рандомизированного исследования (RTOG 85-01). Онкологическая группа лучевой терапии. JAMA 281 , 1623–1627 (1999).

  • 3.

    Crosby, T.D., Brewster, A.E., Borley, A., Perschky, L., Kehagioglou, P., Court, J. et al. Окончательная химиолучевая терапия у пациентов с неоперабельной карциномой пищевода. руб.Дж. Рак 90 , 70–75 (2004).

    КАС пабмед ПабМед Центральный Google Scholar

  • 4.

    Минский Б.Д., Паяк Т.Ф., Гинзберг Р.Дж., Писанский Т.М., Мартенсон Дж., Комаки Р. и соавт. INT 0123 (Radio Therapy Oncology Group 94-05) исследование фазы III комбинированной терапии рака пищевода: высокие дозы по сравнению со стандартными дозами лучевой терапии. Дж. Клин. Онкол. 20 , 1167–1174 (2002).

    КАС Google Scholar

  • 5.

    Wu, S. X., Wang, L. H., Luo, H. L., Xie, C. Y., Zhang, X. B., Hu, W. et al. Рандомизированное исследование фазы III одновременной химиолучевой терапии с расширенным облучением узлов и эрлотинибом у пациентов с неоперабельным плоскоклеточным раком пищевода. евро. Дж. Рак 93 , 99–107 (2018).

    КАС Google Scholar

  • 6.

    Акияма Х., Цурумару М., Удагава Х. и Кадзияма Ю. Радикальная диссекция лимфатических узлов при раке грудного отдела пищевода. Энн. Surg. 220 , 364–372 (1994).

    КАС пабмед ПабМед Центральный Google Scholar

  • 7.

    Ye, T., Sun, Y., Zhang, Y., Zhang, Y. & Chen, H. Резекция с тремя или двумя полями при раке грудного отдела пищевода: метаанализ. Энн. Торак. Surg. 96 , 1933–1941 (2013).

    Google Scholar

  • 8.

    Du, D., Song, T., Liang, X., Fang, M. & Wu, S. Параллельная химиолучевая терапия с избирательным облучением лимфатических узлов при раке пищевода: системный обзор и объединенный анализ литературы . Дис. Пищевод 30 , 1–9 (2017).

    Google Scholar

  • 9.

    Хсу, Ф. М., Ли, Дж. М., Хуан, П. М., Линь, К. С., Хсу, К.H., Tsai, Y.C. и соавт. Ретроспективный анализ различий в исходах предоперационной одновременной химиолучевой терапии с или без планового облучения узлов при плоскоклеточном раке пищевода. Междунар. Дж. Радиат. Онкол. биол. физ. 81 , e593–e599 (2011 г.).

    ПабМед ПабМед Центральный Google Scholar

  • 10.

    Ван К.Л., Ву Т.Т., Чой И.С., Ван Х., Ресеткова Э., Корреа А.М. и соавт. Экспрессия рецептора эпидермального фактора роста в аденокарциномах пищевода и пищеводно-желудочного соединения: связь с плохим исходом. Рак 109 , 658–667 (2007).

    КАС Google Scholar

  • 11.

    Ханава М., Судзуки С., Добаши Ю., Ямане Т., Коно К., Эномото Н. и др. Сверхэкспрессия белка EGFR и амплификация гена при плоскоклеточном раке пищевода. Междунар. Дж. Рак 118 , 1173–1180 (2006).

    КАС Google Scholar

  • 12.

    Jing, W., Yan, W., Liu, Y., Li, J., Yu, J. & Zhu, H. Незначительные преимущества нимотузумаба по сравнению с цетуксимабом в сочетании с химиолучевой терапией при местно-распространенной плоскоклеточной карциноме пищевода. Рак Биол. тер. 20 , 1121–1126 (2019).

    КАС пабмед ПабМед Центральный Google Scholar

  • 13.

    Лю, Х., Ян, В., Гао, Х., Цзян, Т., Гу, Б., Донг, К. и др. Нимотузумаб устраняет приобретенную радиорезистентность клеток рака пищевода KYSE-150R путем ингибирования передачи сигналов EGFR и восстановления клеточной ДНК. Цели Onco Ther. 8 , 509–518 (2015).

    КАС пабмед ПабМед Центральный Google Scholar

  • 14.

    Jing, Z., Gong, L., Xie, C.Y., Zhang, L., Su, H.F., Deng, X. et al. Обратная устойчивость к радиации в клетках карциномы пищевода KYSE-150R после ингибирования сигнального пути рецептора эпидермального фактора роста цетуксимабом. Радиотер. Онкол. 93 , 468–473 (2009).

    КАС Google Scholar

  • 15.

    Wang, X., Niu, H., Fan, Q., Lu, P., Ma, C., Liu, W. et al. Прогностическое значение сверхэкспрессии EGFR и амплификации генов в отношении эффективности котиниба у пациентов с распространенным плоскоклеточным раком пищевода. Oncotarget 7 , 24744–24751 (2016).

    ПабМед ПабМед Центральный Google Scholar

  • 16.

    Петти, Р. Д., Дале-Смит, А., Стивенсон, Д. А. Дж., Осборн, А., Масси, Д., Кларк, К. и др. Аберрации числа копий генов гефитиниба и EGFR при раке пищевода. Дж. Клин. Онкол. 35 , 2279–2287 (2017).

    КАС Google Scholar

  • 17.

    Чиннайян П., Хуанг С., Валлабханени Г., Армстронг Э., Варамбалли С., Томлинс С. А. и соавт. Механизмы усиленного ответа на лучевую терапию после ингибирования передачи сигналов рецептора эпидермального фактора роста эрлотинибом (Тарцева). Рак Рез. 65 , 3328–3335 (2005).

    КАС Google Scholar

  • 18.

    Чжао, К., Линь, Л., Лю, Дж., Лю, Р., Чен, Ю., Ге, Ф. и др. Исследование фазы II одновременной химиолучевой терапии и эрлотиниба при неоперабельной плоскоклеточной карциноме пищевода. Oncotarget 7 , 57310–57316 (2016).

    ПабМед ПабМед Центральный Google Scholar

  • 19.

    Китагава Ю., Уно Т., Ояма Т., Като К., Като Х., Кавакубо Х. и др. Практические рекомендации по лечению рака пищевода 2017 г., изданные Японским обществом пищевода. Пищевод 16 (часть 1), 1–24 (2019).

    ПабМед Google Scholar

  • 20.

    Китагава Ю., Уно Т., Ояма Т., Като К., Като Х., Кавакубо Х. и др. Практические рекомендации по лечению рака пищевода, 2017 г., отредактированные Японским обществом пищевода: часть 2. Пищевод 16 , 25–43 (2019).

    ПабМед ПабМед Центральный Google Scholar

  • 21.

    Кооперативная группа по раку пищевода Общества радиационной онкологии Китайской медицины A. Руководство по лучевой терапии рака пищевода в Китае (проект). Подбородок. Дж. Рак 29 , 855–859 (2010).

    Google Scholar

  • 22.

    Chen, Y., Ye, J., Zhu, Z., Zhao, W., Zhou, J., Wu, C. et al. Сравнение комбинации паклитаксел плюс фторурацил с цисплатином плюс фторурацил при химиолучевой терапии местно-распространенного плоскоклеточного рака пищевода: рандомизированное многоцентровое клиническое исследование фазы III. Дж. Клин. Онкол. 37 , 1695–1703 (2019).

    КАС пабмед ПабМед Центральный Google Scholar

  • 23.

    Jing, Z., Chen, T., Zhang, X. & Wu, S. Долгосрочные результаты одновременной химиолучевой терапии с плановым облучением узлов при неоперабельном раке пищевода. Науки о раке. 108 , 1828–1833 (2017).

    КАС пабмед ПабМед Центральный Google Scholar

  • 24.

    Yoshikawa, D., Ojima, H., Iwasaki, M., Hiraoka, N., Kosuge, T., Kasai, S. et al. Клинико-патологическое и прогностическое значение экспрессии EGFR, VEGF и HER2 при холангиокарциноме. руб. Дж. Рак 98 , 418–425 (2008).

    КАС пабмед ПабМед Центральный Google Scholar

  • 25.

    Грин, С. в Справочник по статистике клинической онкологии 3-е изд. стр. 199–209 (Чепмен и Холл/CRC, 2012).

  • 26.

    Grambsch, P. & Therneau, T. Тесты и диагностика пропорциональных опасностей на основе взвешенных остатков. Биометрика 81 , 515–526 (1994).

    Google Scholar

  • 27.

    Zhang, W., Zhu, H., Liu, X., Wang, Q., Zhang, X., He, J. et al. Рецептор эпидермального фактора роста является предиктором прогноза у пациентов с плоскоклеточным раком пищевода. Энн. Торак. Surg. 98 , 513–519 (2014).

    ПабМед ПабМед Центральный Google Scholar

  • 28.

    Cui, Y., Dong, C., Wu, B.Q., Duan, X.C., Shi, G., Gong, M. et al. Экспрессия циклооксигеназы-2, сосудистого эндотелиального фактора роста и рецептора эпидермального фактора роста у китайских пациентов с плоскоклеточным раком пищевода. J. Рак Res. тер. 11 (Приложение 1), C44–C48 (2015).

    КАС пабмед ПабМед Центральный Google Scholar

  • 29.

    Чжан, Ю. К., Чжан, Дж. Дж., Сонг, Х. Дж. и Ли, Д. В. Экспрессия и прогностическое влияние NF-kappaB и EGFR при раке пищевода. Жене Мол. Рез. 14 , 16819–16826 (2015).

    КАС Google Scholar

  • 30.

    Chen, C. Y., Li, C. C. & Chien, C. R. Приводит ли более высокая доза облучения к лучшему исходу для пациентов с неоперированным локализованным плоскоклеточным раком пищевода, получавших одновременную химиолучевую терапию? Популяционный анализ сопоставления показателей склонности. Радиотер. Онкол. 120 , 136–139 (2016).

    Google Scholar

  • 31.

    Ma, J.B., Song, Y.P., Yu, J.M., Zhou, W., Cheng, E.C., Zhang, X.Q. et al. Возможности конформной лучевой терапии вовлеченного поля при раке шейки матки и верхних отделов пищевода. Onkologie 34 , 599–604 (2011).

    Google Scholar

  • 32.

    Ямасита, Х., Takenaka, R., Omori, M., Imae, T., Okuma, K., Ohtomo, K. et al. Лучевая терапия вовлеченного поля (IFRT) по сравнению с выборочным облучением узлов (ENI) в сочетании с одновременной химиотерапией для 239 случаев рака пищевода: одно институциональное ретроспективное исследование. Радиация. Онкол. 10 , 171 (2015).

    ПабМед ПабМед Центральный Google Scholar

  • 33.

    Ченг Ю. Дж., Цзин С. В., Чжу Л. Л., Ван Дж., Ван Л., Liu, Q. et al. Сравнение выборного облучения узлов и облучения вовлеченного поля при плоскоклеточной карциноме пищевода: метаанализ. Дж. Радиат. Рез. 59 , 604–615 (2018).

    ПабМед ПабМед Центральный Google Scholar

  • 34.

    Sun, Y., Zhang, XL, Mao, QF, Liu, YH, Kong, L. & Li, MH Избирательное облучение узлов или облучение вовлеченного поля при окончательной химиолучевой терапии плоскоклеточного рака пищевода: ретроспектива анализ у клинических пациентов N0. Курс. Онкол. 25 , e423–e429 (2018 г.).

    КАС пабмед ПабМед Центральный Google Scholar

  • 35.

    Zhu, H., Pan, W., Chen, Y., Chen, H., Zuo, Y. & Sun, X. Каков оптимальный размер мишени для лучевой терапии при неоперабельном раке пищевода? метаанализ. Онкол. Рез. Обращаться. 42 , 470–479 (2019).

    Google Scholar

  • 36.

    Li, Q., Zhu, S., Li, S. & Deng, W. Избирательное узловое облучение обеспечивает превосходный терапевтический метод для пациентов с плоскоклеточным раком пищевода с положительной реакцией на лимфатические узлы, получающих радикальную лучевую терапию, по сравнению с облучением вовлеченного поля. Медицина (Балтимор) 98 , e14080 (2019).

    Google Scholar

  • 37.

    Ишикура С., Нихей К., Оцу А., Боку Н., Хиронака С., Мера К. и др. Долговременная токсичность после радикальной химиолучевой терапии плоскоклеточного рака грудного отдела пищевода. Дж. Клин. Онкол. 21 , 2697–2702 (2003).

    КАС Google Scholar

  • 38.

    Hynes, N.E. & Lane, H.A. Рецепторы ERBB и рак: сложность целевых ингибиторов. Нац. Преподобный Рак 5 , 341–354 (2005).

    КАС Google Scholar

  • 39.

    Song, Y., Li, L., Ou, Y., Gao, Z., Li, E., Li, X. et al. Выявление геномных изменений при плоскоклеточном раке пищевода. Природа 509 , 91–95 (2014).

    КАС Google Scholar

  • 40.

    Gao, Z., Meng, X., Mu, D., Sun, X. & Yu, J. Прогностическое значение рецептора эпидермального фактора роста при местно-распространенной плоскоклеточной карциноме пищевода у пациентов, получающих химиолучевую терапию. Онкол. лат. 7 , 1118–1122 (2014).

    КАС пабмед ПабМед Центральный Google Scholar

  • 41.

    Guo, K., Wang, W.P., Jiang, T., Wang, J.Z., Chen, Z., Li, Y. et al. Оценка мутации/количества копий рецептора эпидермального фактора роста и мутации K-ras при раке пищевода. Дж. Торак. Дис. 8 , 1753–1763 (2016).

    ПабМед ПабМед Центральный Google Scholar

  • 42.

    Сваминат А., Райт Дж. Р., Цакиридис Т. К., Унг Ю. К., Понд Г. Р., Сур Р. и другие. Испытание фазы II эрлотиниба и сопутствующей паллиативной торакальной лучевой терапии у пациентов с немелкоклеточным раком легкого. клин. Рак легких 17 , 142–149 (2016).

    КАС пабмед ПабМед Центральный Google Scholar

  • 43.

    Yao, M., Woods, C., Lavertu, P., Fu, P., Gibson, M., Rezaee, R. et al. Исследование фазы II эрлотиниба и доцетаксела с одновременной лучевой терапией с модулированной интенсивностью при местно-распространенном плоскоклеточном раке головы и шеи. Голова Шея 38 (Приложение 1), E1770–E1776 (2016).

    ПабМед ПабМед Центральный Google Scholar

  • 44.

    Komaki, R., Allen, P.K., Wei, X., Blumenschein, G.R., Tang, X., Lee, J.J. et al. Добавление эрлотиниба к химиолучевой терапии улучшает общую выживаемость, но не выживаемость без прогрессирования при немелкоклеточном раке легкого III стадии. Междунар. Дж. Радиат. Онкол. биол. физ. 92 , 317–324 (2015).

    КАС пабмед ПабМед Центральный Google Scholar

  • 45.

    Xu, Y., Zheng, Y., Sun, X., Yu, X., Gu, J., Wu, W. et al.Сопутствующая лучевая терапия гефитинибом у пожилых пациентов с плоскоклеточным раком пищевода: предварительные результаты исследования II фазы. Oncotarget 6 , 38429–38439 (2015).

    ПабМед ПабМед Центральный Google Scholar

  • 46.

    Айер Р., Чатрала Р., Шефтер Т., Ян Г., Малхотра У., Тан В. и др. Эрлотиниб и лучевая терапия у пожилых пациентов с раком пищевода — клинические и корреляционные результаты проспективного многоцентрового исследования фазы 2. Онкология 85 , 53–58 (2013).

    КАС пабмед ПабМед Центральный Google Scholar

  • 47.

    Crosby, T., Hurt, C.N., Falk, S., Gollins, S., Mukherjee, S., Staffurth, J. et al. Химиолучевая терапия с цетуксимабом или без него у пациентов с раком пищевода (SCOPE1): многоцентровое рандомизированное исследование фазы 2/3. Ланцет Онкол. 14 , 627–637 (2013).

    КАС пабмед ПабМед Центральный Google Scholar

  • 48.

    Herrera, F.G., Bourhis, J. & Coukos, G. Возможности комбинации лучевой терапии, усиливающие иммунитет для следующей онкологической практики. CA Cancer J. Clin. 67 , 65–85 (2017).

    ПабМед ПабМед Центральный Google Scholar

  • 49.

    Ji, R.R., Chasalow, S.D., Wang, L., Hamid, O., Schmidt, H., Cogswell, J. et al. Иммуноактивное микроокружение опухоли способствует клиническому ответу на ипилимумаб. Рак Иммунол.Иммунотер. 61 , 1019–1031 (2012).

    КАС пабмед ПабМед Центральный Google Scholar

  • 50.

    Marciscano, A.E., Ghasemzadeh, A., Nirschl, T.R., Theodros, D., Kochel, C.M., Francica, B.J. et al. Избирательное узловое облучение ослабляет комбинированную эффективность стереотаксической лучевой терапии и иммунотерапии. клин. Рак рез. 24 , 5058–5071 (2018).

    КАС пабмед ПабМед Центральный Google Scholar

  • %PDF-1.5 % 1 0 obj >/StructTreeRoot>>>/Pages 4 0 R>>endobj 2 0 obj >endobj 3 0 obj >endobj 4 0 obj >endobj 5 0 obj >>>/Contents [264 0 R 265 0 R 266 0 R]/StructParents 0/MediaBox[0 -0,01 438,95 678,24]>>endobj 6 0 obj >>>/Contents[268 0 R 269 0 R 270 0 R]/StructParents 1/MediaBox[0 0 435,85 682,8]>>endobj 7 0 obj >>>/Contents[275 0 R 276 0 R 277 0 R]/StructParents 2/MediaBox[0 0 438,5 682,8]>>endobj 8 0 obj >>>/Содержание[279 0 Р 280 0 R 281 0 R]/StructParents 3/MediaBox[0 0 435.1 680.4]>>endobj 9 0 obj >>>/Contents[294 0 R 295 0 R 296 0 R]/StructParents 4/MediaBox[0 -0.02 440.4 684.48]>>endobj 10 0 obj >>>/Contents[304 0 R 305 0 R 306 0 R]/StructParents 5/MediaBox[0 0 435.1 681.6]>>endobj 11 0 obj >>>/Contents[318 0 Р 319 0 Р 320 0 R]/StructParents 6/MediaBox[0 0.01 436.3 680.16]>>endobj 12 0 obj >>>/Contents[322 0 R 323 0 R 324 0 R]/StructParents 7/MediaBox[0 0.01 434.4 680.16]>>endobj 13 0 obj >>>/Annots[332 0 R 342 0 R 352 0 R 362 0 R 372 0 R 380 0 R 388 0 R 396 0 R 406 0 R 414 0 R 424 0 R 432 0 р 440 0 R 450 0 R 458 0 R 466 0 R 474 0 R 482 0 R]/Contents[490 0 R 491 0 R 492 0 R]/StructParents 8/MediaBox[0 -0.02 438.25 682.08]>>endobj 14 0 obj >>>/Аннотации[495 0 R 503 0 R 511 0 R 517 0 R]/Содержание[523 0 R 524 0 R 525 0 R]/StructParents 9/MediaBox[0 0 434.65 680.4]>>endobj 15 0 obj >>>/Contents[530 0 R 531 0 R 532 0 R]/StructParents 10/MediaBox[0 0.01 435.35 680.16]>>endobj 16 0 obj >>>/Contents[534 0 R 535 0 Р 536 0 R]/StructParents 11/MediaBox[0 0,02 434,65 679,92]>>endobj 17 0 obj >>>/Contents[574 0 R 575 0 R 576 0 R]/StructParents 12/MediaBox[0 -0.02 435,85 680,88]>>endobj 18 0 obj >>>/Contents[1150 0 R 1151 0 R 1152 0 R]/StructParents 13/MediaBox[0 -0,02 681,1 436,08]>>endobj 19 0 obj >>> /Contents[1181 0 R 1182 0 R 1183 0 R]/StructParents 14/MediaBox[0 -0,01 684,5 441,84]>>endobj 20 0 obj >>>/Contents[1200 0 R 1201 0 R 1202 0 R]/StructParents 15/MediaBox[0 0 437.5 681.6]>>endobj 21 0 obj >>>/Contents[1246 0 R 1247 0 R 1248 0 R]/StructParents 16/MediaBox [0 0 436,8 681,6]>>endobj 22 0 obj >>>/Contents[1259 0 R 1260 0 R 1261 0 R]/StructParents 17/MediaBox[0 0.02 680.15 435.12]>>endobj 23 0 объект >>>/Содержание [1302 0 R 1303 0 R 1304 0 R]/StructParents 18/MediaBox[0 0 435.6 680.4]>>endobj 24 0 obj >>>/Contents[1318 0 R 1319 0 R 1320 0 R] /StructParents 19/MediaBox[0 -0,02 679,9 434,88]>>endobj 25 0 obj >>>/Contents[1341 0 R 1342 0 R 1343 0 R]/StructParents 20/MediaBox[0 0,02 435.6 681.12]>>endobj 26 0 obj >>>/Contents[1345 0 R 1346 0 R 1347 0 R]/StructParents 21/MediaBox[0 -0.02 434.4 680.88]>>endobj 27 0 obj >>>/Содержание[1381 0 Р 1382 0 R 1383 0 R]/StructParents 22/MediaBox[0 0 437.05 680.4]>>endobj 28 0 obj >>>/Contents[1410 0 R 1411 0 R 1412 0 R]/StructParents 23 /MediaBox[0 -0,01 434,9 679,44]>>endobj 29 0 obj >>>/Contents[1436 0 R 1437 0 R 1438 0 R]/StructParents 24/MediaBox[0 -0,01 434,4 680,64]>> endobj 30 0 obj >>>/Contents[1467 0 R 1468 0 R 1469 0 R]/StructParents 25/MediaBox[0 0 434.15 680.4]>>endobj 31 0 obj >>>/Contents[1494 0 R 1495 0 R 1496 0 Р] /StructParents 26/MediaBox[0 -0.01 437.05 680.64]>>endobj 32 0 obj >>>/Contents[1523 0 R 1524 0 R 1525 0 R]/StructParents 27/MediaBox[0 -0.01 438,5 681,84]>>endobj 33 0 obj >>>/Contents[1556 0 R 1557 0 R 1558 0 R]/StructParents 28/MediaBox[0 0,01 435,35 680,16]>>endobj 34 0 obj >>>/Содержание[1664 0 Р 1665 0 R 1666 0 R]/StructParents 29/MediaBox[0 -0,01 679,7 434,64]>>endobj 35 0 obj >>>/Contents[1721 0 R 1722 0 R 1723 0 R]/StructParents 30/MediaBox[0 0,02 679,45 436,32]>>endobj 36 0 obj >>>/Contents[1806 0 R 1807 0 R 1808 0 R]/StructParents 31/MediaBox[0 0,01 678,7 434,16]>> endobj 37 0 obj >>>/Contents[1915 0 R 1916 0 R 1917 0 R]/StructParents 32/MediaBox[0 0 435.35 680.4]>>endobj 38 0 obj >>>/Contents[1992 0 R 1993 0 R 1994 0 R] /StructParents 33/MediaBox[0 0.02 434.15 679.92]>>endobj 39 0 obj >>>/Contents[2123 0 R 2124 0 R 2125 0 R]/StructParents 34/MediaBox[0 0.01 679,2 435,36]>>endobj 40 0 ​​obj >>>/Contents[2216 0 R 2217 0 R 2218 0 R]/StructParents 35/MediaBox[0 -0,02 678,95 433,68]>>endobj 41 0 obj >>>/Содержание[2264 0 Р 2265 0 R 2266 0 R]/StructParents 36/MediaBox[0 -0.02 435.35 680.88]>>endobj 42 0 obj >>>/Contents[2288 0 R 2289 0 R 2290 0 R]/StructParents 37/МедиаБокс[0 0 436.8 682,8]>>endobj 43 0 obj >>>/Contents[2330 0 R 2331 0 R 2332 0 R]/StructParents 38/MediaBox[0 0,02 435,35 679,92]>> endobj 44 0 obj >>>/Contents[2334 0 R 2335 0 R 2336 0 R]/StructParents 39/MediaBox[0 -0.02 433.9 679.68]>>endobj 45 0 obj >>>/Contents[2371 0 R 2372 0 R 2373 0 Р] /StructParents 40/MediaBox[0 -0.01 437.3 680.64]>>endobj 46 0 obj >>>/Contents[2392 0 R 2393 0 R 2394 0 R]/StructParents 41/MediaBox[0 -0.02 436.3 680.88]>>endobj 47 0 obj >>>/Contents[2415 0 R 2416 0 R 2417 0 R]/StructParents 42/MediaBox[0 0.02 437,3 681,12]>>endobj 48 0 obj >>>/Содержание[2441 0 Р 2442 0 R 2443 0 R]/StructParents 43/MediaBox[0 -0,02 435,6 680,88]>>endobj 49 0 obj >>>/Contents[2475 0 R 2476 0 R 2477 0 R]/StructParents 44/MediaBox[0 0 435,6 682,8]>>endobj 50 0 obj >>>/Contents[2525 0 R 2526 0 R 2527 0 R]/StructParents 45/MediaBox[0 -0,02 435,85 683,28] >>endobj 51 0 obj >>>/Contents[2552 0 R 2553 0 R 2554 0 R]/StructParents 46/MediaBox[0 0.02 437.05 682.32]>>endobj 52 0 obj >>>/Contents[2579 0 R 2580 0 Р 2581 0 Р] /StructParents 47/MediaBox[0 0.01 436.55 682.56]>>endobj 53 0 obj >>>/Contents[2652 0 R 2653 0 R 2654 0 R]/StructParents 48/MediaBox[0 -0.01 434.9 683.04]>>endobj 54 0 obj >>>/Contents[2690 0 R 2691 0 R 2692 0 R]/StructParents 49/MediaBox[0 -0.02 433.2 682.08]>>endobj 55 0 obj >>>/Contents[2723 0 R 2724 0 R 2725 0 R]/StructParents 50/MediaBox[0 -0.02 437.75 683.28]>>endobj 56 0 obj >>>/Contents[2741 0 R 2742 0 R 2743 0 R]/StructParents 51/MediaBox[0 0.01 438 683.76]>>endobj 57 0 obj >>>/Contents[2770 0 R 2771 0 R 2772 0 R] /StructParents 52/MediaBox[0 0.01 435.35 681.36]>>endobj 58 0 obj >>>/Contents[2793 0 R 2794 0 R 2795 0 R]/StructParents 53/MediaBox[0 0,01 433,9 681,36]>>endobj 59 0 obj >>>/Contents[2819 0 R 2820 0 R 2821 0 R]/StructParents 54/MediaBox[0 -0,02 435,35 679,68] >>endobj 60 0 obj >>>/Contents[2845 0 R 2846 0 R 2847 0 R]/StructParents 55/MediaBox[0 -0.02 433.45 679.68]>>endobj 61 0 obj >>>/Contents[3333 0 R 3334 0 Р 3335 0 R]/StructParents 56/MediaBox[0 0 681.1 434.4]>>endobj 62 0 obj >>>/Contents[3795 0 R 3796 0 R 3797 0 R]/StructParents 57/MediaBox [0 -0.01 680,9 433,44]>>endobj 63 0 obj >>>/Contents[3954 0 R 3955 0 R 3956 0 R]/StructParents 58/MediaBox[0 0,01 440,4 682,56]>>endobj 64 0 obj >>>/Содержание[4228 0 Р 4229 0 R 4230 0 R]/StructParents 59/MediaBox[0 -0,01 679,9 434,64]>>endobj 65 0 obj >>>/Contents[4283 0 R 4284 0 R 4285 0 R]/StructParents 60/MediaBox[0 0 437.3 682.8]>>endobj 66 0 obj >>>/Contents[4490 0 R 4491 0 R 4492 0 R]/StructParents 61/MediaBox[0 0 683.5 436.8]>>endobj 67 0 obj >>>/Содержание [4520 0 R 4521 0 R 4522 0 R]/StructParents 62/MediaBox[0 0.02 435.1 679.92]>>endobj 68 0 obj >>>/Содержание[4546 0 R 4547 0 R 4548 0 R] /StructParents 63/MediaBox[0 0 436.1 681.6]>>endobj 69 0 obj >>>/Contents[4567 0 R 4568 0 R 4569 0 R]/StructParents 64/MediaBox [0 0 439.2 682.8]>>endobj 70 0 obj >>>/Contents[4647 0 R 4648 0 R 4649 0 R]/StructParents 65/MediaBox[0 0.01 437.5 682.56]>>endobj 71 0 obj >>>/Содержание[4693 0 Р 4694 0 R 4695 0 R]/StructParents 66/MediaBox[0 -0.01 435.35 679.44]>>endobj 72 0 obj >>>/Contents[4762 0 R 4763 0 R 4764 0 R]/StructParents 67/Медиабокс[0 -0.01 438 681,84]>>endobj 73 0 obj >>>/Contents[4781 0 R 4782 0 R 4783 0 R]/StructParents 68/MediaBox[0 0,01 437,5 682,56]>> endobj 74 0 obj >>>/Contents[4785 0 R 4786 0 R 4787 0 R]/StructParents 69/MediaBox[0 -0.02 433.9 680.88]>>endobj 75 0 obj >>>/Contents[4822 0 R 4823 0 R 4824 0 Р] /StructParents 70/MediaBox[0 0 435.35 679.2]>>endobj 76 0 obj >>>/Contents[4845 0 R 4846 0 R 4847 0 R]/StructParents 71/MediaBox[0 -0.01 434,15 679,44]>>endobj 77 0 obj >>>/Contents[4878 0 R 4879 0 R 4880 0 R]/StructParents 72/MediaBox[0 0 435.6 680.4]>>endobj 78 0 obj >>>/Содержание[4903 0 R 4904 0 R 4905 0 R]/StructParents 73/MediaBox[0 0.02 432.95 679.92]>>endobj 79 0 obj >>>/Contents[4960 0 R 4961 0 R 4962 0 R]/StructParents 74/MediaBox[0 0 435,1 680,4]>>endobj 80 0 obj >>>/Contents[4985 0 R 4986 0 R 4987 0 R]/StructParents 75/MediaBox[0 -0,01 435,35 681,84] >>endobj 81 0 obj >>>/Contents[5065 0 R 5066 0 R 5067 0 R]/StructParents 76/MediaBox[0 -0.02 435.35 682.08]>>endobj 82 0 obj >>>/Contents[5090 0 R 5091 0 Р 5092 0 R]/StructParents 77/MediaBox[0 -0.02 435.35 683.28]>>endobj 83 0 obj >>>/Contents[5126 0 R 5127 0 R 5128 0 R]/StructParents 78/MediaBox [0 -0,01 435,1 679,44]>>endobj 84 0 obj >>>/Contents[5150 0 R 5151 0 R 5152 0 R]/StructParents 79/MediaBox[0 -0,02 435,35 680,88]>>endobj 85 0 obj >>>/Contents[5169 0 R 5170 0 R 5171 0 R]/StructParents 80/MediaBox[0 -0.01 438.7 684.24]>>endoobj 86 0 obj >>>/Contents[5190 0 R 5191 0 R 5192 0 R]/StructParents 81/MediaBox[0 -0,02 438 684,48]>>endobj 87 0 obj >>>/Contents[5229 0 R 5230 0 R 5231 0 R] /StructParents 82/MediaBox[0 0.01 437.05 682.56]>>endobj 88 0 obj >>>/Contents[5699 0 R 5700 0 R 5701 0 R]/StructParents 83/MediaBox[0 -0.02 435.6 682.08]>>endobj 89 0 obj >>>/Contents[6032 0 R 6033 0 R 6034 0 R]/StructParents 84/MediaBox[0 -0.01 437.5 685.44]>>endobj 90 0 obj >>>/Содержание[6617 0 Р 6618 0 R 6619 0 R]/StructParents 85/MediaBox[0 -0.01 435.6 684.24]>>endobj 91 0 obj >>>/Contents[6845 0 R 6846 0 R 6847 0 R]/StructParents 86/MediaBox[0 -0.01 435.1 681.84]>>endobj 92 0 obj >>>/Contents[6878 0 R 6879 0 R 6880 0 R]/StructParents 87/MediaBox[0 0.01 433,7 681,36]>> endobj 93 0 obj >>>/Contents[6915 0 R 6916 0 R 6917 0 R]/StructParents 88/MediaBox[0 -0.02 437.5 683.28]>>endobj 94 0 obj >>>/Contents[6950 0 R 6951 0 R 6952 0 Р] /StructParents 89/MediaBox[0 0 433.2 681.6]>>endobj 95 0 obj >>>/Contents[6991 0 R 6992 0 R 6993 0 R]/StructParents 90/MediaBox[0 0 438.25 684]>>endobj 96 0 obj >>>/Contents[7035 0 R 7036 0 R 7037 0 R]/StructParents 91/MediaBox[0 0 436,8 684]>>endobj 97 0 obj >>>/Contents[7061 0 R 7062 0 Р 7063 0 Р] /StructParents 92/MediaBox[0 -0.02 437,75 685,68]>>endobj 98 0 obj >>>/Contents[7090 0 R 7091 0 R 7092 0 R]/StructParents 93/MediaBox[0 0,02 435.6 684.72]>>endobj 99 0 obj >>>/Contents[7123 0 R 7124 0 R 7125 0 R]/StructParents 94/MediaBox[0 0.01 435.1 681.36]>>endobj 100 0 obj >>>/Содержание[7187 0 Р 7188 0 R 7189 0 R]/StructParents 95/MediaBox[0 -0.01 437.05 683.04]>>endobj 101 0 obj >>>/Contents[7204 0 R 7205 0 R 7206 0 R]/StructParents 96/MediaBox[0 -0.02 435.35 680.88]>>endobj 102 0 obj >>>/Contents[7208 0 R 7209 0 R 7210 0 R]/StructParents 97/MediaBox[0 -0.02 433,2 680,88] >>endobj 103 0 obj >>>/Contents[7240 0 R 7241 0 R 7242 0 R]/StructParents 98/MediaBox[0 -0.02 438.25 683.28]>>endobj 104 0 obj >>>/Contents[7267 0 R 7268 0 Р 7269 0 R]/StructParents 99/MediaBox[0 0.01 438 683.76]>>endobj 105 0 obj >>>/Contents[7286 0 R 7287 0 R 7288 0 R]/StructParents 100/MediaBox[0 -0.01 436.8 683.04]>>endobj 106 0 obj >>>/Contents[7457 0 R 7458 0 R 7459 0 R]/StructParents 101/MediaBox[0 -0.01 434.65 683.04]>>endobj 107 0 obj >>>/Contents[7581 0 R 7582 0 R 7583 0 R]/StructParents 102/MediaBox[0 0.01 435.35 680.16]>>endobj 108 0 obj >>>/Contents[7613 0 R 7614 0 R 7615 0 R]/StructParents 103/MediaBox[0 -0,02 433,9 679,68]>>endobj 109 0 obj >>>/Contents[7648 0 R 7649 0 R 7650 0 R]/StructParents 104/MediaBox[0 0,01 437,75 682,56]>>endobj 110 0 obj >>>/Contents[7778 0 R 7779 0 R 7780 0 R]/StructParents 105/MediaBox[0 -0,01 433,2 680,64] >>endobj 111 0 obj >>>/Contents[7807 0 R 7808 0 R 7809 0 R]/StructParents 106/MediaBox[0 0 440.4 682.8]>>endobj 112 0 obj >>>/Содержание[7826 0 R 7827 0 R 7828 0 R]/StructParents 107/MediaBox[0 0 438.7 682.8]>>endobj 113 0 obj >>>/Contents[7907 0 R 7908 0 R 7909 0 R]/StructParents 108/MediaBox[0 -0.02 438.95 683.28]>>endobj 114 0 obj >>>/Contents[7934 0 R 7935 0 R 7936 0 R]/StructParents 109/MediaBox[0 -0.02 438.25 683.28]>>endobj 115 0 obj >>>/Contents[7957 0 R 7958 0 R 7959 0 R]/StructParents 110/MediaBox[0 0.01 439.45 682.56]>>endobj 116 0 obj >>>/Contents[8216 0 R 8217 0 R 8218 0 R]/StructParents 111/MediaBox[0 0 439.9 684]>>endobj 117 0 obj >>>/Contents[8243 0 R 8244 0 R 8245 0 R]/StructParents 112 /MediaBox[0 0,02 439,45 682,32]>>endobj 118 0 obj >>>/Contents[8669 0 R 8670 0 R 8671 0 R]/StructParents 113/MediaBox[0 -0,02 436,8 682,08] >>endobj 119 0 obj >>>/Contents[8698 0 R 8699 0 R 8700 0 R]/StructParents 114/MediaBox[0 -0.01 435.1 679.44]>>endobj 120 0 obj >>>/Contents[8724 0 R 8725 0 Р 8726 0 R]/StructParents 115/MediaBox[0 -0,02 433,9 679,68]>>endobj 121 0 obj >>>/Contents[8751 0 R 8752 0 R 8753 0 R]/StructParents 116/MediaBox [0 0.02 435.85 681.12]>>endobj 122 0 obj >>>/Contents[8794 0 R 8795 0 R 8796 0 R]/StructParents 117/MediaBox[0 0.01 433.9 681.36]>>endobj 123 0 obj >>>/Содержание[8849 0 Р 8850 0 R 8851 0 R]/StructParents 118/MediaBox[0 -0,02 435,35 679,68]>>endobj 124 0 obj >>>/Contents[8871 0 R 8872 0 R 8873 0 R]/StructParents 119/MediaBox[0 -0,02 433,9 679,68]>>endobj 125 0 obj >>>/Contents[8893 0 R 8894 0 R 8895 0 R]/StructParents 120/MediaBox[0 -0,02 438 683.28] >>endobj 126 0 obj >>>/Contents[8938 0 R 8939 0 R 8940 0 R]/StructParents 121/MediaBox[0 0.02 436.3 683.52]>>endobj 127 0 obj >>>/Contents[8977 0 R 8978 0 р 8979 0 R]/StructParents 122/MediaBox[0 0.02 438.7 682.32]>>endobj 128 0 obj >>>/Contents[9042 0 R 9043 0 R 9044 0 R]/StructParents 123/MediaBox [0 -0,01 438,25 683,04]>>endobj 129 0 obj >>>/Contents[9185 0 R 9186 0 R 9187 0 R]/StructParents 124/MediaBox[0 -0,01 435,6 681,84]>>endobj 130 0 obj >>>/Содержание [9222 0 R 9223 0 R 9224 0 R]/StructParents 125/MediaBox[0 0.01 433,2 681,36]>>endobj 131 0 obj >>>/Contents[9266 0 R 9267 0 R 9268 0 R]/StructParents 126/MediaBox[0 -0,01 439,9 681,84]>>endobj 132 0 obj >>>/Содержание[9425 0 Р 9426 0 R 9427 0 R]/StructParents 127/MediaBox[0 0 437.3 681.6]>>endobj 133 0 obj >>>/Contents[9455 0 R 9456 0 R 9457 0 R]/StructParents 128/MediaBox[0 0 439.2 685.2]>>endobj 134 0 obj >>>/Contents[9496 0 R 9497 0 R 9498 0 R]/StructParents 129 /MediaBox[0 0 436.3 684]>>endobj 135 0 obj >>>/Contents[9620 0 R 9621 0 R 9622 0 R]/StructParents 130/MediaBox[0 0.01 435,85 680,16] >>endobj 136 0 obj >>>/Contents[9637 0 R 9638 0 R 9639 0 R]/StructParents 131/MediaBox[0 0.02 680.15 433.92]>>endobj 137 0 obj >>> /Contents[9647 0 R 9648 0 R 9649 0 R]/StructParents 132/MediaBox[0 0.01 680.9 436.56]>>endobj 138 0 obj >>>/Contents[9668 0 R 9669 0 R 9670 0 R]/StructParents 133/MediaBox[0 0.01 433.9 680.16]>>endobj 139 0 obj >>>/Contents[9712 0 R 9713 0 R 9714 0 R]/StructParents 134/MediaBox [0 0,01 435,35 678.96]>>endobj 140 0 obj >>>/Contents[9723 0 R 9724 0 R 9725 0 R]/StructParents 135/MediaBox[0 0,01 435,35 680,16] >>endobj 141 0 obj >>>/Contents[9733 0 R 9734 0 R 9735 0 R]/StructParents 136/MediaBox[0 0 441.35 685.2]>>endobj 142 0 obj >>>/Contents[9758 0 R 9759 0 R 9760 0 R]/StructParents 137/MediaBox[0 0.02 433.2 681.12]>>endobj 143 0 obj >>>/Contents[9786 0 R 9787 0 R 9788 0 R] /StructParents 138/MediaBox[0 0.02 436.1 679.92]>>endobj 144 0 obj >>>/Contents[9812 0 R 9813 0 R 9814 0 R]/StructParents 139/MediaBox[0 0 436.1 681.6]>>endobj 145 0 obj >>>/Contents[9868 0 R 9869 0 R 9870 0 R]/StructParents 140/MediaBox[0 0.02 435.6 681.12]>>endobj 146 0 obj >>>/Contents[9872 0 R 9873 0 R 9874 0 R]/StructParents 141/MediaBox[0 0.01 433.45 681.36]>>endobj 147 0 obj >>>/Contents[9908 0 R 9909 0 R 9910 0 R]/StructParents 142/MediaBox[0 0 437,75 680,4]>>endobj 148 0 obj >>>/Contents[10077 0 R 10078 0 R 10079 0 R]/StructParents 143/MediaBox[0 0,01 436,55 681,36] >>endobj 149 0 obj >>>/Contents[10114 0 R 10115 0 R 10116 0 R]/StructParents 144/MediaBox[0 0.02 437.75 683.52]>>endobj 150 0 obj >>>/Contents[10146 0 R 10147 0 R 10148 0 R]/StructParents 145/MediaBox[0 0.01 437.05 683.76]>>endobj 151 0 obj >>>/Contents[10179 0 R 10180 0 R 10181 0 R]/StructParents 146/MediaBox[0 -0.01 435.6 679.44]>>endobj 152 0 obj >>>/Contents[10206 0 R 10207 0 R 10208 0 R]/StructParents 147/MediaBox[0 0.01 436.1 681.36]>>endobj 153 0 obj >>>/Contents[10244 0 R 10245 0 R 10246 0 R]/StructParents 148/MediaBox[0 0 435.85 680.4]>>endobj 154 0 obj >>>/Содержание[10248 0 R 10249 0 R 10250 0 R]/StructParents 149/MediaBox[0 0.01 433.9 680.16]>>endobj 155 0 obj >>>/Contents[10291 0 R 10292 0 R 10293 0 R]/StructParents 150/MediaBox[0 0.01 436.1 680.16]>>endobj 156 0 obj >>>/Contents[10459 0 R 10460 0 R 10461 0 R]/StructParents 151/MediaBox[0 0.02 433.9 679,92]>>endobj 157 0 obj >>>/Contents[10624 0 R 10625 0 R 10626 0 R]/StructParents 152/MediaBox[0 0,01 438,7 683.76]>>endobj 158 0 obj >>>/Содержание[ 10713 0 R 10714 0 R 10715 0 R]/StructParents 153/MediaBox[0 -0,01 435,6 683,04]>>endobj 159 0 obj >>>/Contents[10762 0 R 10763 0 R 10764 0 R] /StructParents 154/MediaBox[0 -0.01 437.3 683.04]>>endobj 160 0 obj >>>/Contents[10977 0 R 10978 0 R 10979 0 R]/StructParents 155/MediaBox[ 0 -0,01 436,3 683,04]>>endobj 161 0 obj >>>/Contents[11124 0 R 11125 0 R 11126 0 R]/StructParents 156/MediaBox[0 0,01 438 683.76]>>эндобж 162 0 объект >>> /Contents[11277 0 R 11278 0 R 11279 0 R]/StructParents 157/MediaBox[0 0 436.3 684]>>endobj 163 0 obj >>>/Contents[11310 0 R 11311 0 R 11312 0 R]/StructParents 158/MediaBox[0 0.01 438.5 681.36]>>endobj 164 0 obj >>>/Contents[11343 0 R 11344 0 R 11345 0 R]/StructParents 159/MediaBox[0 0,02 438 682,32]>>endobj 165 0 obj >>>/Contents[11375 0 R 11376 0 R 11377 0 R]/StructParents 160/MediaBox[0 -0,01 439,7 684,24] >>endobj 166 0 obj >>>/Contents[11416 0 R 11417 0 R 11418 0 R]/StructParents 161/MediaBox[0 -0.02 437.3 684.48]>>endobj 167 0 obj >>>/Содержание[11469 0 R 11470 0 R 11471 0 R]/StructParents 162/MediaBox[0 0,02 435,85 679,92]>>endobj 168 0 obj >>>/Contents[11473 0 R 11474 0 R 11475 0 R]/StructParents 163/MediaBox[0 -0.02 433.9 679.68]>>endobj 169 0 obj >>>/Contents[11480 0 R 11481 0 R 11482 0 R]/StructParents 164/MediaBox[0 0 435.35 681.6]>>endobj 170 0 obj >>>/Contents[11484 0 R 11485 0 R 11486 0 R]/StructParents 165/MediaBox[0 0 433.2 681.6]>>endobj 171 0 obj >>>/Содержание[11500 0 R 11501 0 R 11502 0 R]/StructParents 166/MediaBox[0 -0.02 438.5 682.08]>>endobj 172 0 obj >>>/Contents[11504 0 R 11505 0 R 11506 0 R]/StructParents 167/MediaBox[0 0,02 432,95 679,92]>>endobj 173 0 obj >>>/Contents[11529 0 R 11530 0 R 11531 0 R]/StructParents 168/MediaBox[0 -0,02 438,95 684.48]>>endobj 174 0 obj >>>/Contents[11552 0 R 11553 0 R 11554 0 R]/StructParents 169/MediaBox[0 0.01 436.3 683,76]>>endobj 175 0 obj >>>/Содержание[ 11579 0 R 11580 0 R 11581 0 R]/StructParents 170/MediaBox[0 0,02 435,35 679,92]>>endobj 176 0 obj >>>/Annots[11603 0 R 11610 0 R 11616 0 R 11622 0 R 11628 0 R 11634 0 R 11640 0 R 11646 0 R 11652 0 R]/Contents[11658 0 R 11659 0 R 11660 0 R]/StructParents 171/MediaBox [0 0 435,85 681,6]>>endobj 177 0 obj >>>/Contents[11679 0 R 11680 0 R 11681 0 R]/StructParents 172/MediaBox[0 0,01 435,35 682,56]>>endobj 178 0 объект >>> /Contents[11708 0 R 11709 0 R 11710 0 R]/StructParents 173/MediaBox[0 0.02 436.1 683.52]>>endobj 179 0 obj >>>/Содержание[11734 0 R 11735 0 R 11736 0 R] /StructParents 174/MediaBox[0 -0.01 437.5 681.84]>>endobj 180 0 obj >>>/Contents[11745 0 R 11746 0 R 11747 0 R]/StructParents 175/MediaBox[ 0 -0,01 433,2 680,64]>>endobj 181 0 obj >>>/Contents[11778 0 R 11779 0 R 11780 0 R]/StructParents 176/MediaBox[0 0 437,75 684]>>endobj 182 0 obj >>>/Содержание[ 11807 0 R 11808 0 R 11809 0 R]/StructParents 177/MediaBox[0 -0.01 433.45 681.84]>>endobj 183 0 obj >>>/Содержание[11848 0 R 11849 0 R 11850 0 R] /StructParents 178/MediaBox[0 0.02 438.5 682.32]>>endobj 184 0 obj >>>/Contents[11872 0 R 11873 0 R 11874 0 R]/StructParents 179/MediaBox[ 0 0 435,6 681,6]>>endobj 185 0 obj >>>/Contents[11912 0 R 11913 0 R 11914 0 R]/StructParents 180/MediaBox[0 -0,01 438 684,24]>>endobj 186 0 obj >>>/Содержание[ 11953 0 R 11954 0 R 11955 0 R]/StructParents 181/MediaBox[0 0 435.85 684]>>endobj 187 0 obj >>>/Contents[12027 0 R 12028 0 R 12029 0 R]/StructParents 182/MediaBox[0 -0.01 439.2 683.04]>>endobj 188 0 obj >>>/Contents[12044 0 R 12045 0 R 12046 0 R]/StructParents 183/MediaBox[0 -0.01 436.1 681.84]>>endobj 189 0 obj >>>/Contents[12071 0 R 12072 0 R 12073 0 R]/StructParents 184/MediaBox[0 0 439.45 685.2]>>endobj 190 0 obj >>>/Contents[12109 0 R 12110 0 R 12111 0 R]/StructParents 185/MediaBox[0 0,01 437,75 684.96]>>endobj 191 0 obj >>>/Contents[12426 0 R 12427 0 R 12428 0 R]/StructParents 186/MediaBox[0 0 434,9 680,4]>>endobj 192 0 obj >>>/Contents[12435 0 R 12436 0 R 12437 0 R]/StructParents 187/MediaBox[0 -0,01 432,95 680,64] >>endobj 193 0 obj >>>/Contents[12460 0 R 12461 0 R 12462 0 R]/StructParents 188/MediaBox[0 0.01 435.1 681.36]>>endobj 194 0 obj >>>/Contents[12464 0 R 12465 0 р 12466 0 R]/StructParents 189/MediaBox[0 0.02 432.95 681.12]>>endobj 195 0 obj >>>/Contents[12501 0 R 12502 0 R 12503 0 R]/StructParents 190/Медиабокс[0 -0.02 435.6 680.88]>>endobj 196 0 obj >>>/Contents[12540 0 R 12541 0 R 12542 0 R]/StructParents 191/MediaBox[0 0.01 435.1 682.56]>>endobj 197 0 obj >>>/Contents[12568 0 R 12569 0 R 12570 0 R]/StructParents 192/MediaBox[0 -0.02 435.35 683.28]>>endobj 198 0 obj >>>/Содержание[ 12599 0 R 12600 0 R 12601 0 R]/StructParents 193/MediaBox[0 0.01 437.05 684.96]>>endobj 199 0 obj >>>/Contents[12767 0 R 12768 0 R 12769 0 R] /StructParents 194/MediaBox[0 -0.02 437.75 682.08]>>endobj 200 0 obj >>>/Contents[12801 0 R 12802 0 R 12803 0 R]/StructParents 195/MediaBox[ 0 0 436,8 681,6]>>endobj 201 0 obj >>>/Contents[12826 0 R 12827 0 R 12828 0 R]/StructParents 196/MediaBox[0 -0,01 442,1 686,64]>>endobj 202 0 obj >>>/Содержание[ 13030 0 R 13031 0 R 13032 0 R]/StructParents 197/MediaBox[0 0.01 436.8 683.76]>>endobj 203 0 obj >>>/Contents[13385 0 R 13386 0 R 13387 0 R] /StructParents 198/MediaBox[0 -0.01 440.65 684.24]>>endobj 204 0 obj >>>/Contents[13532 0 R 13533 0 R 13534 0 R]/StructParents 199/MediaBox[ 0 0 439,45 684]>>endobj 205 0 obj >>>/Contents[14126 0 R 14127 0 R 14128 0 R]/StructParents 200/MediaBox[0 0 441,6 686,4]>>endobj 206 0 obj >>>/Содержание[ 14429 0 R 14430 0 R 14431 0 R]/StructParents 201/MediaBox[0 -0.01 439.2 685.44]>>endobj 207 0 obj >>>/Contents[14598 0 R 14599 0 R 14600 0 R] /StructParents 202/MediaBox[0 0,02 434.9 681.12]>>endobj 208 0 obj >>>/Contents[14632 0 R 14633 0 R 14634 0 R]/StructParents 203/MediaBox[ 0 0 435,35 681,6]>>endobj 209 0 obj >>>/Contents[14653 0 R 14654 0 R 14655 0 R]/StructParents 204/MediaBox[0 0,01 438,5 684,96]>>endobj 210 0 obj >>>/Содержание[ 14657 0 R 14658 0 R 14659 0 R]/StructParents 205/MediaBox[0 0.01 433.7 682.56]>>endobj 211 0 obj >>>/Contents[14683 0 R 14684 0 R 14685 0 R] /StructParents 206/MediaBox[0 0,01 436,1 681.36]>>endobj 212 0 obj >>>/Contents[14713 0 R 14714 0 R 14715 0 R]/StructParents 207/MediaBox[0 -0.02 433.7 680.88]>>endobj 213 0 obj >>>/Contents[14743 0 R 14744 0 R 14745 0 R]/StructParents 208/MediaBox[0 0 436.8 684] >>endobj 214 0 obj >>>/Contents[14766 0 R 14767 0 R 14768 0 R]/StructParents 209/MediaBox[0 -0.01 433.7 683.04]>>endobj 215 0 obj >>>/Contents[14779 0 R 14780 0 Р 14781 0 R]/StructParents 210/MediaBox[0 -0,02 439,45 683,28]>>endobj 216 0 obj >>>/Contents[14783 0 R 14784 0 R 14785 0 R]/StructParents 211/МедиаБокс[0 0.02 433,7 681,12]>>endobj 217 0 obj >>>/Contents[14826 0 R 14827 0 R 14828 0 R]/StructParents 212/MediaBox[0 0 440,4 685,2] >>endobj 218 0 obj >>>/Contents[14830 0 R 14831 0 R 14832 0 R]/StructParents 213/MediaBox[0 -0.01 433.9 681.84]>>endobj 219 0 obj >>>/Contents[14837 0 R 14838 0 Р 14839 0 R]/StructParents 214/MediaBox[0 -0,02 437,75 680,88]>>endobj 220 0 obj >>>/Contents[14841 0 R 14842 0 R 14843 0 R]/StructParents 215/MediaBox[0 0,01 433.9 680,16]>>endobj 221 0 obj >>>/Contents[14871 0 R 14872 0 R 14873 0 R]/StructParents 216/MediaBox[0 -0,01 440,15 685.44]>>endobj 222 0 obj >>>/Contents[14896 0 R 14897 0 R 14898 0 R]/StructParents 217/MediaBox[0 -0.02 439.7 685.68]>>endobj 223 0 obj >>>/Содержание[ 14927 0 R 14928 0 R 14929 0 R]/StructParents 218/MediaBox[0 -0.01 442.55 684.24]>>endobj 224 0 obj >>>/Contents[15024 0 R 15025 0 R 15026 0 R]/StructParents 219/MediaBox[0 0,02 439.7 683.52]>>endobj 225 0 obj >>>/Contents[15453 0 R 15454 0 R 15455 0 R]/StructParents 220/MediaBox [0 0.02 439.2 683.52]>>endobj 226 0 obj >>>/Contents[15533 0 R 15534 0 R 15535 0 R]/StructParents 221/MediaBox[0 0.01 436.1 682.56]>>endobj 227 0 объект >>> /Contents[15560 0 R 15561 0 R 15562 0 R]/StructParents 222/MediaBox[0 0 439.9 682.8]>>endobj 228 0 obj >>>/Contents[15605 0 R 15606 0 R 15607 0 R] /StructParents 223/MediaBox[0 -0,01 436,8 681.84]>>endobj 229 0 obj >>>/Contents[15635 0 R 15636 0 R 15637 0 R]/StructParents 224/MediaBox[ 0 0 438,25 684]>>endobj 230 0 obj >>>/Contents[15654 0 R 15655 0 R 15656 0 R]/StructParents 225/MediaBox[0 -0,01 436,3 683,04]>>endobj 231 0 obj >>>/Содержание[ 15742 0 R 15743 0 R 15744 0 R]/StructParents 226/MediaBox[0 -0.01 438.25 683.04]>>endobj 232 0 obj >>>/Contents[15832 0 R 15833 0 R 15834 0 R] /StructParents 227/MediaBox[0 0,01 436,3 682.56]>>endobj 233 0 obj >>>/Contents[15890 0 R 15891 0 R 15892 0 R]/StructParents 228/MediaBox[ 0 0,02 439,2 684,72]>>endobj 234 0 obj >>>/Contents[15954 0 R 15955 0 R 15956 0 R]/StructParents 229/MediaBox[0 -0,02 436,55 683.28]>>endobj 235 0 obj >>>/Contents[15958 0 R 15959 0 R 15960 0 R]/StructParents 230/MediaBox[0 0 435.6 682.8]>>endobj 236 0 obj >>>/Contents [15979 0 R 15980 0 R 15981 0 R]/StructParents 231/MediaBox[0 -0,02 439,45 684.48]>>endobj 237 0 obj >endobj 238 0 obj >endobj 239 0 obj >endobj 240 0 obj >endobj 241 0 obj >endobj 242 0 obj >endobj 243 0 obj >endobj 244 0 obj >endobj 245 0 obj >endobj 246 0 obj >endobj 247 0 obj >endobj 248 0 obj >endobj 249 0 obj >endobj 250 0 obj >endobj 251 0 obj >endobj 252 0 obj >endobj 253 0 obj >endobj 254 0 obj >endobj 255 0 obj >endobj 256 0 obj >endobj 257 0 obj >endobj 258 0 obj >stream

    Схема комбинированного облучателя и системы считывания Riso.

    Контекст 1

    … основные рабочие компоненты используемого здесь считывателя Riso TL/OSL (модель TL/OSL-DA-20) показаны на рис. 1, а именно: система обнаружения света, система стимуляции люминесценции (тепловой и оптический) и источник излучения. На рис. 2 показана установка в целом. Система обнаружения света состоит из фотоумножителя (ФЭУ) в сочетании с соответствующими фильтрами обнаружения, а система стимуляции люминесценции состоит из нагревателя…

    Контекст 2

    … в отношении облучения электронами в диапазоне от 6 МэВ до 16 МэВ, в отношении двух нижних энергий (6 и 9 МэВ) отмечается почти линейная характеристика (рис. 10) . И наоборот, для двух больших энергий облучения (12 и 16 МэВ) есть указание на возможное приближение к насыщению обнаружения, возможно, в результате зависимости ЛПЭ. В качестве альтернативы, еще одно соображение заключается в том, что такое поведение может быть результатом потенциальных потерь тормозного излучения, зависящих от толщины образца, что в настоящее время является проблемой…

    Контекст 3

    … образцы предметных стекол из боросиликатного стекла, было проведено исследование зависимости энергии пучка для диапазона фотонных пучков, доступного в ходе настоящих исследований, от 80 кВп до 10 МВ. На рис. 11 показан полученный сравнительный выход TL, нормализованный к выходу, полученному при 6 МВ. Неудивительной является фотоэлектрическая зависимость, полученная при более низких значениях луча, полученная с использованием рентгеновского аппарата Gulmay, отражающая эффективный атомный номер стеклянной среды около 11.4 (преобладает фракционное содержание Si и O 2 в …

    Контекст 4

    … кремний чистоты, лишенный дефектов. Растет интерес к потенциальной дозиметрической полезности боросиликатного стекла и его реакции на нейтроны , с первоначальными показаниями, полученными в результате наблюдений, проведенных при 10 МВ, по сравнению с наблюдениями при 6 МВ, что частично является результатом образования фотонейтронов, ситуация, которая возникает около порогового уровня 10 МВ Рис. слайды для доз от 10 сГр до 2000 сГр для мегавольтных энергий электронов.Баллы относятся к среднему значению 5 отдельных образцов. Рис. 11. ТЛ-отклик предметных стекол из боросиликатного стекла, облученных киловольтным рентгеновским излучением (80, 140 и 250 кВп) и мегавольтными фотонами в дозе 4 Гр (6 и 10…

    Контекст 5

    .. , сделанные при 10 МВ по сравнению с 6 МВ, что предположительно частично является результатом производства фотонейтронов, ситуация, которая возникает около порогового уровня 10 МВ Рис. сГр до 2000 сГр для мегавольтных энергий электронов.Баллы относятся к среднему значению 5 отдельных образцов. Рис. 11. ТЛ-отклик предметных стекол из боросиликатного стекла, облученных до дозы 4 Гр кВ рентгеновским излучением (80, 140 и 250 кВпик) и мегавольтными фотонами (6 и 10 МВ, все нормированы на отклик при 6 …

    Ультрафиолетовое (УФ) излучение

    Что такое УФ-излучение?

    Ультрафиолетовое (УФ) излучение представляет собой форму электромагнитного излучения, которое исходит от солнца и искусственных источников, таких как солярии и сварочные горелки.

    Излучение – это испускание (рассылка) энергии из любого источника. Существует много типов излучения, от очень высокоэнергетического (высокочастотного) излучения, такого как рентгеновские лучи и гамма-лучи , до очень низкоэнергетического (низкочастотного) излучения, такого как радиоволны. УФ-лучи находятся в середине этого спектра. У них больше энергии, чем у видимого света, но не так много, как у рентгеновских лучей.

    Существуют также различные типы УФ-лучей в зависимости от того, сколько энергии они имеют. Ультрафиолетовые лучи более высокой энергии являются формой ионизирующего излучения .Это означает, что у них достаточно энергии, чтобы удалить электрон из (ионизировать) атом или молекулу. Ионизирующее излучение может повредить ДНК (гены) в клетках, что, в свою очередь, может привести к раку. Но даже самые мощные УФ-лучи не обладают достаточной энергией для глубокого проникновения в организм, поэтому их основное воздействие приходится на кожу.

    УФ-излучение делится на 3 основные группы:

    • УФ-лучи имеют наименьшую энергию среди УФ-лучей. Эти лучи могут вызвать старение клеток кожи и вызвать косвенное повреждение ДНК клеток.Лучи UVA в основном связаны с долгосрочным повреждением кожи, таким как морщины, но также считается, что они играют роль в некоторых раковых заболеваниях кожи.
    • UVB-лучи обладают немного большей энергией, чем UVA-лучи. Они могут напрямую повредить ДНК в клетках кожи и являются основными лучами, вызывающими солнечные ожоги. Также считается, что они вызывают большинство видов рака кожи.
    • УФ-лучи обладают большей энергией, чем другие типы УФ-лучей. К счастью, из-за этого они реагируют с озоном высоко в нашей атмосфере и не достигают земли, поэтому обычно они не являются фактором риска развития рака кожи.Но УФ-излучение также может исходить из некоторых искусственных источников, таких как горелки для дуговой сварки, ртутные лампы и ультрафиолетовые дезинфицирующие лампы, используемые для уничтожения бактерий и других микробов (например, в воде, воздухе, пище или на поверхностях).

    Как люди подвергаются воздействию УФ-излучения?

    Солнечный свет

    Солнечный свет является основным источником УФ-излучения, хотя УФ-лучи составляют лишь небольшую часть солнечных лучей. Различные типы УФ-лучей достигают земли в разном количестве. Около 95 % УФ-лучей, достигающих земли, составляют УФ-лучи А, а остальные 5 % — УФ-В лучи.

    Сила УФ-лучей, достигающих земли, зависит от ряда факторов, таких как:

    • Время суток:  УФ-лучи наиболее сильны с 10:00 до 16:00.
    • Сезон года:  УФ-лучи сильнее весной и летом. Вблизи экватора этот фактор менее важен.
    • Расстояние от экватора (широта):  Ультрафиолетовое излучение уменьшается по мере удаления от экватора.
    • Высота над уровнем моря:  УФ-лучи достигают земли на больших высотах.
    • Облака:  Воздействие облаков может быть разным, но важно знать, что УФ-лучи могут проникать на землю даже в пасмурный день.
    • Отражение от поверхностей:  УФ-лучи могут отражаться от таких поверхностей, как вода, песок, снег, тротуар или даже трава, что приводит к увеличению воздействия УФ-излучения.
    • Содержимое воздуха:  Озон в верхних слоях атмосферы, например, отфильтровывает часть УФ-излучения.

    Степень воздействия УФ-излучения на человека зависит от силы лучей, продолжительности воздействия на кожу и от того, защищена ли кожа одеждой или солнцезащитным кремом.

    Искусственные источники УФ-лучей

    Люди также могут подвергаться воздействию искусственных источников УФ-лучей. К ним относятся:

    • Лампы и солярии (солярии и кабины): Количество и тип УФ-излучения, которому человек подвергается в солярии (или кабине), зависит от конкретных ламп, используемых в солярии, от того, как долго человек находится в солярии. кровать, и сколько раз человек использует ее. Большинство современных УФ-соляриев излучают в основном УФА-лучи, а остальные — УФВ.
    • Фототерапия (УФ-терапия):  Некоторым кожным заболеваниям (например, псориазу) помогает лечение ультрафиолетовым светом. Для лечения, известного как PUVA, сначала вводится препарат под названием псорален. Препарат накапливается в коже и делает ее более чувствительной к ультрафиолету. Затем пациента обрабатывают УФ-излучением. Другим вариантом лечения является использование только УФБ (без лекарств).
    • Лампы черного света:  В этих лампах используются лампы, испускающие УФ-лучи (в основном УФ-А).Лампа также излучает видимый свет, но у нее есть фильтр, который блокирует большую его часть, пропуская при этом УФ-лучи. Эти лампочки имеют фиолетовое свечение и используются для просмотра флуоресцентного материала. Ловушки для насекомых также используют «черный свет», который испускает некоторое количество ультрафиолетовых лучей, но лампы используют другой фильтр, который заставляет их светиться синим цветом.
    • Ртутные лампы: Ртутные лампы можно использовать для освещения больших общественных мест, таких как улицы или спортивные залы. Они не подвергают людей воздействию ультрафиолетовых лучей, если они работают должным образом.На самом деле они состоят из двух ламп: внутренней, излучающей свет и УФ-лучи, и внешней, фильтрующей УФ-излучение. Воздействие ультрафиолета может произойти только в том случае, если внешняя колба сломана. Некоторые ртутные лампы устроены таким образом, что отключаются сами при разрыве внешней колбы. Те, у которых нет этой функции, должны быть установлены только за защитным слоем или в местах, где люди не будут подвергаться воздействию, если часть лампы сломается.
    • Ксеноновые и ксенон-ртутные дуговые лампы высокого давления, плазменные горелки и сварочные дуги:  Ксеноновые и ксенон-ртутные дуговые лампы используются в качестве источников света и УФ-лучей для многих целей, таких как УФ-отверждение , покрытия и т.д.), дезинфекции, для имитации солнечного света (например, для проверки солнечных батарей) и даже в фарах некоторых автомобилей. Большинство из них, наряду с плазменными горелками и сварочными дугами, в основном вызывают озабоченность с точки зрения воздействия УФ-излучения на рабочем месте.

    Вызывает ли УФ-излучение рак?

    Большинство случаев рака кожи возникает в результате воздействия УФ-лучей на солнце. Как базально-клеточный, так и плоскоклеточный рак (наиболее распространенные типы рака кожи), как правило, обнаруживаются на участках тела, подвергающихся воздействию солнца, и их возникновение обычно связано с пребыванием на солнце в течение всей жизни.Риск меланомы, более серьезного, но менее распространенного типа рака кожи, также связан с воздействием солнца, хотя, возможно, не так сильно. Рак кожи также был связан с воздействием некоторых искусственных источников УФ-лучей.

    Что показывают исследования?

    Многие исследования показали, что базальноклеточный и плоскоклеточный рак кожи связаны с определенным поведением, которое заставляет людей находиться на солнце, а также с рядом маркеров пребывания на солнце, таких как:

    • Проведение времени на солнце для отдыха (включая посещение пляжа)
    • Проводить много времени на солнце в купальнике
    • Жизнь в районе, который получает много солнечного света
    • Серьезные солнечные ожоги в прошлом (большее количество солнечных ожогов связано с повышенным риском)
    • Имеющие признаки повреждения кожи солнечными лучами, такие как печеночные пятна, актинический кератоз (огрубевшие участки кожи, которые могут быть предраковыми) и солнечный эластоз (утолщенная, сухая, морщинистая кожа, вызванная воздействием солнца) на шее

    Исследования также выявили связь между определенным поведением и маркерами пребывания на солнце и меланомой кожи , в том числе:

    • Деятельность, которая приводит к «периодическому воздействию солнца», например солнечные ванны, водные виды спорта и отдых в солнечных местах
    • Предыдущие солнечные ожоги
    • Признаки повреждения кожи солнечными лучами, такие как печеночные пятна, актинический кератоз и солнечный эластоз

    Поскольку УФ-лучи не проникают глубоко в организм, нельзя ожидать, что они вызовут рак внутренних органов, и большинство исследований не обнаружили такой связи.Однако некоторые исследования показали возможную связь с некоторыми другими видами рака , включая карциному из клеток Меркеля (менее распространенный тип рака кожи) и меланому глаза.

    Исследования показали, что люди, которые используют солярии (или кабины) , имеют более высокий риск развития рака кожи, включая меланому, плоскоклеточный и базально-клеточный рак кожи. Риск меланомы выше, если человек начал загорать в помещении до 30 лет. или 35, и риск базально-клеточного и плоскоклеточного рака кожи выше, если солярий начали использовать до 25 лет.

    Что говорят экспертные агентства?

    В общем, Американское онкологическое общество не определяет, вызывает ли что-то рак (то есть является ли это канцерогеном ) , но мы обращаемся за помощью в других уважаемых организациях. На основании имеющихся данных несколько экспертных агентств оценили канцерогенную природу УФ-излучения.

    Международное агентство по изучению рака (IARC)  является частью Всемирной организации здравоохранения (ВОЗ).Одной из его основных целей является выявление причин рака. На основании имеющихся данных IARC сделало следующие выводы:

    • Солнечное излучение является канцерогенным для человека .
    • Использование устройств для загара с ультрафиолетовым излучением является канцерогенным для человека .
    • УФ-излучение (включая УФА, УФВ и УФС) является канцерогенным для человека .

    Национальная токсикологическая программа (NTP)  образована из частей нескольких различных государственных учреждений США, включая Национальные институты здравоохранения (NIH), Центры по контролю и профилактике заболеваний (CDC) и Управление по санитарному надзору за качеством пищевых продуктов и медикаментов ( FDA).НТП приняла следующие решения:

    • Солнечное излучение известно как канцероген для человека .
    • Воздействие солнечных ламп или соляриев является известным канцерогеном для человека .
    • УФ-излучение широкого спектра действия известно как канцероген для человека .
    • УФА-излучение обоснованно считается канцерогеном для человека .
    • УФ-излучение обоснованно считается канцерогеном для человека .
    • УФ-излучение обоснованно считается канцерогеном для человека .

    (Дополнительную информацию о системах классификации, используемых этими агентствами, см. в разделе Определение того, является ли что-то канцерогеном.)

    Как насчет соляриев?

    Некоторые люди думают, что ультрафиолетовые лучи в солярии — это безопасный способ получить загар, но это не так.

    И IARC , и NTP классифицируют использование устройств для загара, излучающих УФ-излучение (включая лампы для загара и солярии), как канцерогенные для человека.

      Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA),  , которое называет все УФ-лампы, используемые для загара, «лампами для загара», требует, чтобы они имели этикетку с надписью: «Внимание! возраст 18 лет».

    FDA также требует, чтобы инструкции для пользователей и коммерческие материалы, предназначенные для потребителей (включая каталоги, листы спецификаций, описательные брошюры и веб-страницы), содержали следующие утверждения:

    • Противопоказания: Этот продукт противопоказан для использования лицами моложе 18 лет.
    • Противопоказание: Этот продукт нельзя использовать при наличии повреждений кожи или открытых ран.
    • Предупреждение: этот продукт не следует использовать у лиц, у которых был рак кожи или у которых в семейном анамнезе был рак кожи.
    • Предупреждение: лица, неоднократно подвергавшиеся воздействию УФ-излучения, должны регулярно проходить обследование на предмет рака кожи.

    Управление по санитарному надзору за качеством пищевых продуктов и медикаментов также предложило новое правило, запрещающее использование устройств для загара в помещении лицами моложе 18 лет, требующее, чтобы солярии информировали взрослых пользователей о рисках для здоровья, связанных с солярием в помещении, и требовало подписанного подтверждения риска от всех пользователей. .Некоторые штаты США уже запретили солярий всем лицам моложе 18 лет, в то время как другие запретили использование солярия младшими подростками и детьми.

    Есть ли другие проблемы со здоровьем, связанные с УФ-излучением?

    В дополнение к раку кожи воздействие УФ-лучей может вызвать другие проблемы со здоровьем:

    • УФ-лучи, исходящие как от солнца, так и от искусственных источников, таких как солярии, могут вызывать солнечные ожоги .
    • Воздействие УФ-лучей может вызвать преждевременное старение кожи и признаки солнечного повреждения , такие как морщины, кожистая кожа, печеночные пятна, актинический кератоз и солнечный эластоз.
    • Ультрафиолетовые лучи также могут вызывать проблемы с глазами . Они могут вызвать воспаление или ожог роговицы (в передней части глаза). Они также могут привести к образованию катаракты (помутнение хрусталика глаза) и птеригиума (разрастание тканей на поверхности глаза), оба из которых могут ухудшить зрение.
    • Воздействие УФ-лучей также может ослабить иммунную систему , так что организму труднее бороться с инфекциями. Это может привести к таким проблемам, как реактивация герпеса, вызванная воздействием солнца или других источников ультрафиолетовых лучей.Это также может привести к тому, что вакцины будут менее эффективными.

    Некоторые люди более чувствительны к вредному воздействию УФ-излучения. Некоторые лекарства также могут сделать вас более чувствительными к ультрафиолетовому излучению, повышая вероятность солнечных ожогов. И некоторые медицинские условия могут ухудшиться из-за УФ-излучения.

    УФ-лучи и витамин D

    Ваша кожа естественным образом вырабатывает витамин D, когда подвергается воздействию ультрафиолетовых лучей солнца. Количество витамина D, которое вы вырабатываете, зависит от многих факторов, в том числе от вашего возраста, темной кожи и интенсивности солнечного света в том месте, где вы живете.

    Витамин D имеет много преимуществ для здоровья. Это может даже помочь снизить риск некоторых видов рака. В настоящее время врачи не уверены, каков оптимальный уровень витамина D, но в этой области проводится много исследований.

    По возможности лучше получать витамин D из пищи или витаминных добавок, а не из-за воздействия УФ-лучей. Диетические источники и витаминные добавки не увеличивают риск рака кожи и, как правило, являются более надежными способами получить необходимое количество.

    Можно ли избежать воздействия УФ-излучения?

    УФ-лучи солнечного света

    Невозможно (и не полезно) полностью избегать солнечного света, но есть способы убедиться, что вы не получаете слишком много солнца:

    • Если вы собираетесь находиться на улице, просто оставайтесь в тени , особенно в полуденные часы, это один из лучших способов ограничить воздействие УФ-излучения от солнечного света.
    • Защитите свою кожу с помощью одежды , закрывающей руки и ноги.
    • Носите головной убор , чтобы защитить голову, лицо и шею.
    • Носите солнцезащитные очки , блокирующие ультрафиолетовые лучи, чтобы защитить глаза и кожу вокруг них.
    • Используйте солнцезащитный крем , чтобы защитить кожу, не закрытую одеждой.

    Для получения дополнительной информации см. Как защитить себя от ультрафиолетовых (УФ) лучей?

    Центры по контролю и профилактике заболеваний США (CDC) также рекомендовали сообществам способы предотвращения рака кожи путем уменьшения воздействия солнечных лучей, включая образовательные мероприятия в школах и обеспечение тени в школах, местах отдыха и рабочих местах.

    Искусственные источники УФ-лучей

    Многие люди считают, что ультрафиолетовые лучи соляриев безвредны. Это неправда. Лучше всего не пользоваться соляриями (или кабинами).

    Люди, которые могут подвергаться воздействию искусственных источников УФ-излучения на своей работе , должны соблюдать соответствующие меры предосторожности, в том числе использовать защитную одежду, УФ-щиты и фильтры.

    Радиационная стойкость

    Радиационная стойкость
    Далее: Испытания балки Up: Проектирование и строительство Предыдущий: Калибровка по космическим лучам &nbsp Содержимое

    Радиационная стойкость

    На заводе КЕК Б большое количество мягких лучей, имеющих энергии до нескольких МэВ генерируются электронами отработавшего пучка и позитроны, попадающие в лучевые трубы и маски радиационной защиты.То доза наведенного фона луча в районе ствола была оценивается до 5 рад/год на первых 2 см глубины при устойчивом работа при интегральной светимости /г. С большой запас прочности, установлено требование по радиационной стойкости таким образом, что светоотдача снижается до менее чем 3 %, 10 % и 20 % при дозах облучения 10, 100 и 1000 рад соответственно. Согласно предыдущим измерениям, это не было само собой разумеющимся. будут ли удовлетворять этому требованию наши кристаллы CsI().
    Для проверки радиационной стойкости несколько полноразмерных кристаллов производства каждого производителя были облучены до 1000 рад Co. источник 51 ТБк на облучательной установке Токийского института Технология [61]. Интенсивность облучения составляла около 3, 3 и 25 рад/мин для облучения 10, 100 и 1000 рад соответственно. Длина затухания 1,17 и 1,33 МэВ -квантов от Источник Co составляет около 5,4 см в кристалле CsI.
    Облучение проводилось двумя способами: (а) равномерное облучение, при котором кристаллы облучали с боков кристалла по всей область и (б) облучение передней стороны, при котором стороны кристаллы были экранированы и облучение производилось спереди Поверхность, имитирующая реальный случай.Радиационное поражение это ограничено в передней области, и примерно 90 % от общего доза поглощается в первых 10 см от общей длины 30 см. Световыход облученных кристаллов измерялся в двух методы: один с фотоумножителем (PM) (Hamamatsu R1847-S) и источник Cs, а другой с двумя фотодиодами (PD) (Hamamatsu S2744-08, чувствительная зона 10 мм 20 мм) и мюоны космических лучей. Последнее расположение такое же, как и в действительности. Белль ЭКЛ.
    Наблюдались два вида восстановления повреждений после облучения: (1) уменьшение интенсивности фосфоресценции и (2) частичное восстановление светоотдачи. Интенсивность рассеянного фосфоресценция была слишком сильной, чтобы измерить фотоэлектрический пик 662 кэВ -лучи сразу после облучения. После периода от нескольких часов до суток интенсивность уменьшалась и ослабевала до уровень, на котором измерения были возможны. В общем, потеря светоотдача кристалла CsI() после частичного радиационного повреждения выздоровел.На рис. показана типичная история светоотдачи. измеряется с помощью ФЭУ. Световой поток частично восстановился во время период около 1, 2 и 4 недель после облучения 10, 100 и 1000 рад соответственно. Если специально не указано иное, мы используем насыщенное значение светоотдачи при каждой дозе.
    Рисунок: Зависимость светоотдачи от времени при равномерном облучении (показания ФЭУ).
    Световой поток, измеренный с помощью ФЭУ и ФД, в зависимости от дозы для фронтальное облучение показано на Инжир.. Результаты с ФЭУ и с ФД согласуются на уровне нескольких %. То На рисунке видно, что все испытанные кристаллы, кроме прототипа сделано Шанхайским институтом керамики (SIC), удовлетворяет требованиям радиационной стойкости до 1000 рад. Радиационная стойкость SIC кристаллы были улучшены для выполнения требования путем легирования материал со свойством аннулировать подозрительную примесь. На рис. представлены результаты светоотдачи для новых Кристаллы SIC и исходный прототип кристаллов SIC, измеренные с использованием показания ФЭУ после фронтального облучения.
    Рисунок: Световой поток в зависимости от дозы облучения для передней части лица облучение. Верхние и нижние цифры — данные с ФЭУ. считывание и считывание ЧР соответственно. Значения светоотдачи нормализованы к таковым до облучения. Толстая линия представляет собой требование по радиационной стойкости ЭХЛ. Все кристаллы, кроме для SIC-прототипов удовлетворяют требованию.
    Рисунок: Световой поток новых кристаллов SIC в зависимости от дозы облучения (фронтальное облучение).
    Позиционная зависимость светоотдачи, измеренная с помощью ФЭУ и ФД показания для равномерного и фронтального облучения указывают на то, что изменение светоотдачи мало зависит от положения вдоль кристалл, даже для фронтального облучения. Сам этот результат является хорошее свидетельство того, что механизм излучения мерцаний в Кристаллы CsI() мало подвержены облучению. Мы заключаем что только общие коэффициенты усиления должны быть скорректированы для эффекта радиационного поражения в условиях эксплуатации.
    Результаты исследований механизма радиационного повреждения свидетельствуют о том, что Основная причина радиационного поражения связана с деградацией длина затухания, вызванная образованием центров окраски, а чем ухудшение механизма свечения сцинтилляций. Окрашивание CsI() в красный или коричневый цвет наблюдали после облучение. Степень окраски коррелировала с изменением в светоотдаче. Кристаллы-прототипы Шанхайского института Керамику (SIC) окрашивали при облучении 100 рад, а при Новосибирск (NOV) и Crismatec были на уровне 1000 рад или выше.в при фронтальном облучении наблюдалось окрашивание передняя область и передняя часть кристаллов-прототипов SIC стали красными после облучения в 100 рад.
    Для выяснения причин радиационного поражения мы измерили спектры пропускания, возбуждения и излучения на 0, 10, 100, облучение спектрофотометрами в дозе 1000 рад. Нарезанные кусочки 5,5 см 5,5 см 2,7 см размером были использованы для этих исследования. Коэффициент пропускания измерялся на толщине 5.5 см с воспроизводимостью 1 %. Измерения возбуждение и излучение производились на поверхности каждого кристалла с несколько худшая воспроизводимость 5 %. Результаты для Прототип SIC и NOV показаны на Инжир. . Четкие полосы поглощения около 430 и 520 нм на кривых пропускания можно увидеть для SIC прототип, свидетельствующий о формировании центров окраски. С другой С другой стороны, ухудшение пропускания было небольшим для NOV.А Моделирование трассировки лучей методом Монте-Карло также подтвердило идею о том, что Основным результатом радиационного поражения является образование центров окраски.
    Рисунок: Спектры пропускания по толщине 5,5 см и возбуждения и излучения на поверхности каждого кристалла через 0, 10, Облучение 100 и 1000 рад для прототипа SIC и NOV. То данные пропускания были скорректированы с учетом потерь на отражение поверхности. На коэффициенте пропускания наблюдаются четкие полосы поглощения. кривая для прототипа SIC.Спектры возбуждения и излучения исправлены за зависимость квантовой эффективности от длины волны ПМТ.


    Далее: Испытания балки Up: Проектирование и строительство Предыдущий: Калибровка по космическим лучам &nbsp Содержимое
    Само Станик 2001-06-02

    Ионное облучение одностенных углеродных нанотрубок с электронным разделением: Модель радиационных эффектов в наноструктурированном углероде: Journal of Applied Physics: Vol 112, No 3

    Структурные и электрические свойства электронно-разделенных (металлических и полупроводниковых) ) тонкие пленки из одностенных углеродных нанотрубок (SWCNT) были исследованы после облучения 150 кэВ 11 B + и 150 кэВ 31 P + с флюенсами в диапазоне от 10 12 4 до 10 12 4 /см 2 .Результаты спектроскопии комбинационного рассеяния показывают, что отношение интенсивностей пиков полос комбинационного рассеяния D к G’ ( D/G ‘) является более чувствительным индикатором структурной модификации ОУНТ, индуцированной ионным облучением, на один порядок по сравнению с отношением интенсивностей пиков комбинационного рассеяния D пиковой интенсивности полосы G ( D/G ). Увеличение поверхностного сопротивления ( R s ) тонких пленок следует той же тенденции, что и отношение D/G ′, предполагая, что радиационно-индуцированное изменение объемного электрического переноса для обоих электронных типов одинаково и связанных с локальным образованием дефектов.Результаты характеристики для различных образцов сравниваются на основе дозы повреждения смещения ( DDD ), переданной образцу, которая не зависит от материала и источника повреждения. Таким образом, можно расширить анализ, включив в него данные облучения перенесенных CVD-графеновых пленок на подложках SiO 2 /Si с использованием ионов C + с энергией 35 кэВ и сравнить наблюдаемые изменения при эквивалентных уровнях ионного облучения. повреждения, наблюдаемые в тонкопленочных образцах ОУНТ.В конечном итоге разработана модель для прогнозирования радиационного отклика наноструктурированных углеродных материалов на основе DDD для любого падающего иона с низкоэнергетическими спектрами отдачи. Модель также связана с концентрацией дефектов и, следовательно, с эффективной длиной от дефекта к дефекту, и дает максимальную концентрацию дефектов (минимальную длину от дефекта к дефекту), выше которой объемные электрические транспортные свойства в тонких пленках SWCNT и большом графене Электронные устройства на основе быстро разрушаются при воздействии суровых условий.

    БЛАГОДАРНОСТЬ

    Авторы выражают благодарность правительству США за финансирование через Агентство по уменьшению угрозы обороны (DTRA) в рамках гранта HDTRA-1-10-1-0122. Этот материал основан на работе, полностью или частично финансируемой правительством США, и любые мнения, выводы, выводы или рекомендации, выраженные в этом материале, принадлежат автору (авторам) и не обязательно отражают точку зрения правительства США. . Р. А. Дилео признателен аспирантам за финансирование стипендии GAANN в рамках программы RIT Microsystems Engineering PhD.Авторы также благодарят Джеймса К. Калбертсона за его вклад в рамановский анализ, а также Пола Яроша и Томаса Мастранжело за полезные технические обсуждения.

    Сайленсинг CircRNA-016901 ослабляет индуцированное облучением повреждение костных мезенхимальных стволовых клеток посредством регуляции оси miR-1249-5p/HIPK2

    Введение

    Эволюция костей увеличивает способности животных избегать опасностей, а костные стволовые клетки постоянно производят кость клетки для поддержания костного гомеостаза (1).Выживаемость и старение скелетного стебля клетки регулируются многочисленными физиологическими факторами (2,3), включая секретируемый семафорин класса 3 (2), паратгормон (4), индуцируемый гипоксией фактор 1α (5) и некодирующую РНК (6,7). То образование и поддержание остеобластов связано с метаболизм глутамина и патологические процессы (1,8), такие как по мере развития лейкемии (9) и гематологические злокачественные новообразования (10). При клиническом лечении внешние стрессоры (включая гипоксию и радиация) повреждают клетки и вызывают иммунный ответ (11).Некодирующая РНК опосредует клеточный иммунные реакции на вредные раздражители (12,13) и в мезенхимальных стволовых клетках костного мозга (СКМСК) (14).

    В последнее время исследования по лечению крови болезни на молекулярном уровне привлекли широкое внимание (15-17). СККМ представляют собой тип мультипотентных стволовых клеток, которые участвуют в формирование костномозгового (КМ) кроветворного микроокружения (18), который более устойчив к радиации, чем гемопоэтические стволовые клетки (19). СККМ являются важными структурными и функциональные компоненты восстановления и реконструкции кроветворения, после лучевого поражения (19).Перед трансплантацией органов пациенты подвергаются тотальному облучение (ЧМТ) (20). Предыдущий исследования показали, что пациенты, получающие ЧМТ для уничтожения инфицированные ткани и клетки до трансплантации КМ страдают повреждение здоровых клеток костного мозга, таких как стромальные клетки костного мозга (21-23). Кроме того, в предыдущих исследованиях сообщалось, что BMSC трансплантации стимулируют кроветворение, ускоряют лимфоцитарный восстановление и способствовать восстановлению тканей (24,25). Однако на ранней стадии трансплантации СККМ могут подвергаться различные побочные реакции, включая окислительный стресс, гипоксию и воспалительные реакции (26).Сообщалось, что облучение способствует самонаведению СККМ после Трансплантация СККМ (27,28). Кроме того, облучение способствует трансплантированные СККМ для имплантации и индукции образования новых кость (29). Таким образом, соответствующие молекулярные механизмы, лежащие в основе радиационно-индуцированного повреждения СККМ требуют исследования для открытия новых стратегий облучения травма, повреждение.

    Циркулярная РНК (цирРНК) широко экспрессируется в клетки млекопитающих и представляет собой тип некодирующей эндогенной молекулы РНК который регулирует экспрессию генов (30).Многочисленные исследования продемонстрировали что циркРНК может играть важную роль в развитии различные заболевания, в том числе неврологические расстройства, сахарный диабет и виды рака (31-33), указывая на то, что circRNAs могут быть важным биомаркером для прогнозирование течения заболевания и прогноза. Предыдущее исследование сообщили, что профили экспрессии circRNAs в мышиных СККМ были значительно изменены после облучения (34). Кроме того, уровни экспрессии circRNA-011235 и circRNA-016901 были значительно увеличены в мышиных СККМ после облучения (34).Однако может ли circRNA-016901 влияет на радиационно-индуцированное повреждение СККМ и связанное с ним молекулярные механизмы остаются неясными и требуют дальнейшего исследование.

    МикроРНК (миРНК или миР) представляют собой класс некодирующих малые молекулы РНК, которые участвуют в различных важных физиологические и патологические процессы (35), такие как астма (36), старение мозга (37) и рак предстательной железы (38). МиРНК действуют главным образом комплементарно спаривание с 3′-нетранслируемой областью (UTR) области гена-мишени мРНК (39) для деградации или ингибирования его выражение (40).Более того, микроРНК выполняют важные регуляторные функции для роста и развитие, а также возникновение и развитие различных заболеваний, в том числе ишемической болезни сердца и хронических лимфолейкоз (41). А предыдущее исследование показало, что экспрессия miR-1249-5p значительно увеличивается у пациентов с хронической перемежающейся гипоксией, получающих эндотелиальных клеток аорты мышей и тесно связан с апоптоз и аутофагия (42). В виде ранее сообщалось, что миР-1249 ингибирует пролиферацию клеток, процессы инвазии, миграции и эпителиально-мезенхимального перехода при колоректальном раке (43).Кроме того, анализ микрочипов показал, что miR-1249-5p была активируется при различных видах рака, включая миксому сердца и толстой кишки рак, что указывает на то, что миР-1249-5p может выполнять функцию, стимулирующую опухоль (44,45). Было продемонстрировано, что миР-1249-5p активироваться при гепатоцеллюлярной карциноме и участвовать в регуляция апоптоза (46). Появляется все больше доказательств того, что circRNAs связываются с miRNAs для регулируют функцию микроРНК (47). Биоинформатический анализ показал, что circ-016901 содержал сайт связывания миР-1249-5p.Однако роль circ-016901 и миР-1249-5p в регуляции радиационного повреждения СККМ остается неясным.

    Гомеодомен-взаимодействующая протеинкиназа (HIPK) представляет собой серин/треониновая протеинкиназа, расположенная в ядре и HIPK подсемейство включает HIPK1, HIPK2 и HIPK3(48). В качестве транскрипционного фактора HIPK2 регулирует клеточную дифференцировку, пролиферацию, ангиогенез и апоптоз и связан с развитием и прогрессированием опухоли (49-51). Недавнее исследование показало, что HIPK2 является геном-супрессором опухоли. влияет на биологические характеристики различных опухолей, включая плоскоклеточный рак пищевода (52).Кроме того, HIPK2 является ключевым регулятор почечного фиброза и является сывороточным маркером (53). Предыдущее исследование продемонстрировало что HIPK2 активирует функцию p53 под действием УФ-облучения, тем самым стимулирование апоптоза (54). Кроме того, было предсказано, что HIPK2 будет одним из кандидатов гены-мишени для миР-1249-5p с помощью биоинформатики TargetScan анализ. Однако функция оси miR-1249-5p/HIPK2 в радиационно-индуцированное повреждение СККМ и потенциальное молекулярное механизмы еще предстоит выяснить.

    Настоящее исследование направлено на изучение экспрессия и потенциальная роль circ-016901, miR-1249-5p и HIPK2 на аутофагию и апоптоз при радиационно-индуцированном повреждении СККМ, которые могут предоставить новые клинические мишени для защиты СККМ от лучевое поражение.

    Материалы и методы
    Выделение, культивирование и идентификационный номер

    Были рассмотрены все процедуры для животных и эвтаназия органами местного самоуправления в соответствии с местными Комитет по уходу Третьей больницы Сянъя Центрального Юга Университет (Хунань, Китай) в соответствии с Хельсинкским Декларация.

    Взрослые самцы мышей BALB/c (возраст 8-10 недель; вес, 18-25 г) были приобретены в Центре лабораторных животных Третья больница Сянъя Центрального Южного Университета, Хунань, Китай. Мышей содержали при температуре 22±2°C, влажности 40-60% и 12-часовом режиме свет/темнота. циклы. Мыши имели свободный доступ к пище и воде. Всего 50% объем/мин скорость потока CO2 использовалась для эвтаназии (55). Когда объем CO2 достигал 70%, мыши теряли сознание (лежачее положение без мышечного тонуса) в течение 30 секунд, таким образом, мышей эвтаназия с использованием CO2 в сочетании с вывихом шейки матки.Этот метод позволил избежать влияния аномальной гипоксии на результаты экспериментов. Поскольку все экзогенные факторы были одинаковыми, когда мышей умерщвляли, аномальные эффекты клеточной аутофагии и можно исключить апоптоз, вызванный гипоксией на СККМ.

    Большеберцовая кость и бедренная кость были вырезаны у мышей хирургическим путем. и погружают в 75% раствор этанола при 25°С на несколько секунд для дезинфицировать костномозговую полость проксимальнее конца большеберцовой кости и бедра, которых коснулись ножницы. Голень и бедренная кость были промыты в α-модификации минимально необходимой среды (α-MEM) (Кот.нет. 36450; Stemcell Technologies, Inc.) с добавлением 10% FBS (кат. № F2442; Sigma-Aldrich; Merck KGaA) и 5 ​​ЕД/мл гепарина (каталожный номер BP2524100; Thermo Fisher Scientific, Inc.) и кости костный мозг собирали.

    Клетки дважды промывали α-MEM без гепарина. среде и высевали в чашки Петри (плотность посева, 2х106 клеток/мл) через 24 ч забора костного мозга. Через три дня клетки трижды промывали PBS для удаления неприкрепленные клетки и культивировали в среде DMEM (кат. №11965092; Thermo Fisher Scientific, Inc.) с добавлением 10% FBS. Клетки культивировали в инкубаторе при 37°C, содержащем 5% CO2 в течение 24 часов. При 80% слиянии СККМ расщепляли 0,25% трипсином. (кат. № MFCD00130286; Sigma-Aldrich; Merch KGaA) при 37°C в течение 2 мин, доводили до плотности 1х106 кл/мл, отмывали дважды с PBS и центрифугировали при 300 x g в течение 5 мин при 4°C. FITC-меченый кластер дифференцировки (CD) 34 (кат. № 553733; BD Biosciences), CD45 (номер по каталогу 553080; BD Biosciences) и стволовые клеточный антиген 1 (Sca-1) (кат.нет. аб25031; Abcam) в смеси с CD90 (кат. № 1740-02; SouthernBiotech) добавляли к ячейке суспензии и инкубируют 15-25 мин при 20-25°С в темноте. После этого СККМ идентифицировали с помощью проточной цитометрии (ZE5 анализатор клеток; Кот. нет. 12004279; BioRad Laboratories, Inc.), данные анализировали с использованием программного обеспечения FlowJo (версия 10.0; FlowJo LLC).

    После идентификации с помощью проточной цитометрии, соотношение положительных клеток CD34, CD45, Sca-1 и CD90 составляло 0,75, 0,96, 99,42 и 98,01% соответственно, что указывает на то, что большинство клетки представляли собой CD34(-), CD45(-), Sca-1(+) и CD90(+).То идентификация и характеристики СККМ были основаны на иммунофенотип СККМ мыши (56). Выделенные и идентифицированные клетки были использовать для последующих исследований.

    Обработка облучением

    Суспензии одиночных клеток СККМ (плотность посева, 2×106 клеток/мл) высевали в 96-луночный культуральный планшет. пока клетки не достигнут 80% слияния. Клетки были разделены на 4 группы и облучали 0 (контрольная группа), 2, 4 или 6 Гр для различные моменты времени 6, 12 и 24 ч при комнатной температуре условиях (25˚C) в поле рентгеновского излучения линейного ускоритель (2008 Synergy s/n 151765; Elekta) при мощности дозы 0.4 Гр/мин при расстоянии до источника 100 см.

    Трансфекция

    Клетки в логарифмической фазе роста были трансфицированные (плотность высева 1,5х105 клеток/мл). Малая интерферирующая (si)РНК Circ-016901, миметики miR-1249-5p, HIPK2 миРНК или соответствующие контроли, скремблированные миРНК (NC) или контроль миметики (все GenePharma, Inc.) трансфицировали в СККМ с использованием Набор реагентов для трансфекции Lipofectamine® 2000 (номер по каталогу 11668030; Thermo Fisher Scientific, Inc.), согласно протокол производителя.Последовательности и масса всех миРНК/миРНК были перечислены в Таблице I. трансфекцию проводили при 37°С в течение 48 часов. В 24 часа посттрансфекция, эффективность трансфекции миРНК и гиперэкспрессия была обнаружена с помощью обратного транскрипционно-количественная ПЦР (RT-qPCR).

    Таблица I

    Последовательности и масса всех миРНК/миРНК в трансфекции.

    Таблица I

    Последовательности и масса всех миРНК/миРНК в трансфекции.

    Имя Последовательность (5’→3′) Масса (мкг)
    circ-016901 миРНК GGGCTGGTTCTTCTTTCACATA 3,33
    Скремблированная миРНК негатис контроль GTGCTTATCAGCCGGTTTCTA 3.33
    miR-1249-5p имитирует UCCUCCCUCCCCUACCCGGUUCAAG 4
    контроль микроРНК имитирует UUUGUACUACACAAAAGUACUG 4
    HIPK2 миРНК GATCACTCCACCACGTAGACT 3.33
    Репортерный анализ двойной люциферазы

    circ-016901 и HIPK2, как было определено, содержат сайты связывания миР-1249-5p с использованием Starbase (версия 2.0; http://starbase.sysu.edu.cn/index.php), TargetScan (версия 7.2; http://www.targetscan.org/vert_72/) и IntaRNA (версия 2.0; http://rna.informatik.uni-freiburg.de/IntaRNA/Input.jsp) базы данных. Впоследствии миР-1249-5p имитирует и имитирует контроль. субклонировали в репортерный вектор люциферазы Renilla псиЧЕК-2 (Корпорация Промега) по паспорту производителя инструкции.Circ-016901 и HIPK2 дикого типа (WT) и мутантный (MUT) Репортерные векторы с двойной люциферазой были сконструированы и котрансфицированы миметиком miR-1249-5p или контролем NC с использованием Липофектамин® 2000 (каталожный номер 11668030; Thermo Fisher Scientific, Inc.), в соответствии с протоколом производителя. После инкубации в течение 48 часов при 37°C в среде с 5% CO2 инкубаторе, клетки собирали и определяли на наличие люциферазы активность с использованием анализа Dual-Luciferase® Reporter 1000 системы (Корпорация Промега) и представлена ​​в виде соотношения светлячков активности люциферазы Renilla.

    Набор для подсчета клеток (CCK)-8 для анализа

    Клетки, обработанные различными дозами и временем облучения высевали в 96-луночные планшеты (плотность посева, 5×103 клеток/лунку) и культивировали в инкубаторе при 37°С. содержащий 5% CO2. Пролиферацию клеток измеряли при 0, через 24, 48 и 72 часа после посева с использованием набора для анализа CCK-8 (кат. № аб228554; Abcam) согласно протоколу производителя. Кратко, В каждую лунку добавляли по 10 мкл раствора CCK-8. Следующий инкубация в течение 1 ч при 37°С в инкубаторе с 5% СО2, оптическую плотность (оптическую плотность, ОП) каждой лунки измеряли с помощью микропланшет-ридер (BMG Labtech, GmbH) при длине волны 450 нм и был использован для расчета относительного числа клеток по отношению абсорбция от ≥3 объемов.

    Анализ проточной цитометрии

    клеток в каждой группе лечения были дополнены бессывороточная среда DMEM для индукции апоптоза. Короче говоря, клетки были расщепляли 0,25% трипсином при 37°С в течение 2 мин. подготовить сингл клеточную суспензию и дважды промывали ледяным PBS. Клетки были инкубировали с аннексином V-FITC (каталожный номер ab14085; Abcam) в течение 10 мин. при комнатной температуре (25°С). После этого раствор зонда, 50 Добавляли мкг/мл йодида пропидия (PI; кат. № ab14083; Abcam). непосредственно в клеточную суспензию.Клетки инкубировали в течение 30 мин при комнатной температуре в темноте перед проточным цитометрическим анализом. Затем клетки промывали свежей DMEM без сыворотки. То интенсивность флуоресценции определяли с помощью проточной цитометрии (ZE5 Cell анализатор; Кот. нет. 12004279; Bio-Rad Laboratories, Inc.) и скорость апоптоза измеряли с помощью средства обнаружения апоптоза аннексина V-PI. комплект (Abcam), согласно протоколу производителя. Данные были проанализировано с использованием программного обеспечения FlowJo (версия 10.0; FlowJo LLC).

    Анализ активности каспазы-3/7

    После трансфекции 100 мкл клеточной суспензии добавляли в 96-луночные планшеты (плотность посева 1×106 клеток/мл).Реагент Caspase-Glo (каталожный номер G8200; Promega Корпорация) добавляли в каждую лунку в соотношении 1:1. принцип. Клетки осторожно центрифугировали при 80-120 g при 4°C в течение 30 сек и инкубируют 2 ч при комнатной температуре. Инкубированный образец Затем планшеты помещали в люминометр для микропланшетов Veritas™. (Promega Corporation) для определения значения флуоресценции каждого образец для анализа данных.

    Выделение РНК и RT-qPCR

    Тотальную РНК экстрагировали из клеток с использованием Реактив TRIzol® (кат.нет. 15596026; Термо Фишер Scientific, Inc.), в соответствии с протоколом производителя. кДНК первой цепи синтезировали с помощью обратной транскрипции из общая РНК с использованием набора для обратной транскрипции кДНК высокой емкости (номер по каталогу 4368814; Thermo Fisher Scientific, Inc.), качество было определяется с использованием OD260/OD280 на приборе NanoDrop ND-1000 (Agilent Technologies, Inc.) и обработаны РНКазой R (каталожный номер 19101; Qiagen China Co., Ltd.) для удаления линейных РНК. КПЦР был выполняется с использованием SYBR-Green PCR Master Mix (кат.нет. 4367660; Термо Fisher Scientific, Inc.) на системе ПЦР в реальном времени ViiA 7 (каталожный номер 4453545; Термо Фишер Сайентифик, Инк.). Эксперименты были выполняется в трех экземплярах. Условия термоциклирования, используемые для количественной ПЦР были следующими: этап активации УНГ при 50°С в течение 2 мин; денатурация в течение 30 с при 95°С; затем 40 циклов денатурации по 5 сек. при 95°С и отжиг в течение 30 с при 60°С. мРНК GAPDH использовали для нормализовать уровни экспрессии генов-мишеней. U6 использовался для нормализация уровня экспрессии miR-1249-5p.Относительная мРНК уровни экспрессии рассчитывали с использованием 2-ΔΔCq метод (57). Используемые последовательности праймеров в настоящем исследовании были следующими: circ-016901 вперед, 5′-ACAGCGCTAC ACTTGTTCCGA-3′ и наоборот, 5′-GACGATGCTA TCCAG ГАГАГТ-3′; миР-1249-5p вперед, 5′-GAGGAGGG AGGGGATG-3′ и обратный, 5′-TCCAGTTTTTTTTTTTTTTTTGAACTTG-3′; ХИПК2 вперед, 5′-CTTCAGGAG CCATCGCCTAC-3′ и наоборот, 5′-CTGTTG TGCGGG ААГГТТА-3′; легкая цепь 3 (LC3) вперед, 5′-ATGCCGTC CGAGAAG-3′ и наоборот, 5′-TTACACAG CCATTGCTG-3′; Беклин-1 нападающий, 5′-CGGAATTCTATGGAAGGGTCTAA GACGTCC-3′ и наоборот, 5′-CGGGATCCTCATTGTT ATAAAATTGTGAGGACA-3′; U6 нападающий, 5′-CTCGCTTC GGCAGCACA-3′ и наоборот, 5′-AACGCTTCACGAAT TTGCGT-3′; и ГАДФ вперед, 5′-CACTGAGCAAG AGAGGCCCTAT-3′ и обратно, 5′-GCAGCGAACTTTAT TGATGGTATT-3′.

    Вестерн-блоттинг

    Каждую группу клеток промывали PBS, центрифугировали при 300×g при 4°C в течение 5 мин и отбрасывали супернатант. Клетки лизировали на льду в течение 30 минут с использованием белкового лизата RIPA (кат. нет. аб7937; Abcam) и центрифугировали при 11 500 g в течение 20 мин при 4°C. Были добавлены ингибиторы протеазы (каталожный номер 635673; Takara Bio, Inc.). к клеточным лизатам. Затем клетки помещали на лед на 30 мин до полного растворения и супернатант переносили в новую трубка ЭП.Концентрацию общего белка определяли с помощью прибора Pierce™. Набор для анализа белков BCA (номер по каталогу 23227; Thermo Fisher Scientific, Inc.), согласно протоколу производителя. Белки были разделяли с помощью 12% SDS-PAGE (15 мкг белка/гелевая дорожка) и переносили к мембранам PVDF (EMD Millipore). Мембраны были заблокированы 5% обезжиренного молока в течение 1 ч при 25°С. После этого были получены первичные антитела. добавляли и клетки инкубировали в течение ночи при 4°С. После мытья с TBST, кроличьи антимышиные антитела, конъюгированные с пероксидазой хрена вторичные антитела иммуноглобулина G (1:5000; кат.нет. 61-6520; Добавляли Thermo Fisher Scientific, Inc.) и инкубировали в течение 1 ч при комнатная температура. Полосы белков определяли с помощью ECL™ Western. Реагенты для обнаружения блоттинга (кат. № RPN2209; Sigma-Aldrich; Merck КГаА). Значения серого для каждой полосы белка были проанализированы с использованием ImageJ программное обеспечение (версия 1.46; Национальный институт здравоохранения). Кроме того, значения серого, полученные в каждой группе, были по сравнению со значениями серого соответствующей полосы β-актина до анализировать уровни экспрессии белков. Соотношение LC3-II/LC3-I было рассчитано на основе значений серого LC3-II и LC3-I.Начальный использовались следующие антитела: LC3 (1:1000; кат. № M152-3; Медицинские и биологические лаборатории Co., Ltd.), Беклин-1 (1:1000; каталожный номер NB500-249; Novus Biologicals, Inc.), HIPK2 (1:1000; кат. номер 5091; Cell Signaling Technology, Inc.) и β-актин (1:5000; каталожный номер 3700S; New England BioLabs, Inc.).

    Заявление об этике

    Все процедуры с животными проводились в соответствии с руководящие принципы, одобренные Институциональным управлением по уходу за животными и их использованию Комитет Третьей больницы Сянъя Центрального Южного Университета, Хунань, Китай (разрешение №.2019-S534).

    Статистический анализ

    Статистический анализ выполнен с использованием SPSS программного обеспечения (версия 19.0; IBM Corp.) и данные представлены как среднее значение ± среднеквадратичное отклонение. Различия между группами анализировали с помощью односторонний или двусторонний дисперсионный анализ с последующим апостериорным тестом Бонферрони, и непарные t-критерии Стьюдента. Все эксперименты были проведены и анализировали в трехкратной повторности. Считалось, что P<0,05 указывает на статистически значимая разница.

    Результаты
    Уровни экспрессии circ-016901, миР-1249-5p и HIPK2 связаны с облучением СККМ

    Для изучения влияния радиации на СККМ, воздействие различных доз (2, 4 и 6 Гр) радиации на пролиферацию СККМ исследовали с использованием анализов CCK-8.В сравнении с контрольной группой, лечение облучением значительно уменьшал пролиферацию клеток СККМ в дозозависимой способом (рис. 1А; P<0,01). То Уровни экспрессии мРНК и белков генов, связанных с аутофагией (включая Beclin-1 и LC3) были обнаружены при различных облучениях дозы с помощью RT-qPCR и вестерн-блоттинга соответственно. Результаты показали, что уровни экспрессии мРНК и белка Beclin-1 были значительно снижены в облученных СККМ в дозозависимым образом по сравнению с контрольной группой (рис.1В и С; Р<0,01). Кроме того, хотя Экспрессия мРНК LC3 была значительно снижена, не было значительная разница в соотношении LC3-II/LC3-I по сравнению с контрольная группа. Кроме того, облучение значительно повышал экспрессию circ-016901 и HIPK2 и подавлял Экспрессия миР-1249-5p зависит от времени и дозы в СККМ по сравнению с контрольной группой (рис. 1D-F; P<0,01). Таким образом, 6 ГГ доза и 24-часовой момент времени использовались для всех последующих исследований.Кроме того, результаты показали, что лечение облучением значительно повышенная активность каспазы-3/7 (рис. 1G) и усиление апоптоза в СККМ и (рис. 1H; P<0,01). То текущие результаты показали, что circ-016901, miR-1249-5p и HIPK2 имели потенциальные регулирующие эффекты при радиационно-индуцированном поражении СККМ.

    Рисунок 1

    Уровни экспрессии circ-016901, миР-1249-5p и HIPK2 связаны с облучением СККМ. (А) Влияние различных доз облучения на пролиферацию СККМ измеряли с использованием набора для подсчета клеток-8.(Б) мРНК и (C) уровни экспрессии белка Beclin-1 и LC3-II/I в СККМ. обработанных различными дозами облучения, были обнаружены с помощью RT-qPCR и вестерн-блоттинг соответственно. Уровни экспрессии (D) circ-016901, (E) miR-1249-5p и (F) HIPK2 в обработанных СККМ. при различных дозах облучения выявляли с помощью RT-qPCR. Выявлены скорости апоптоза СККМ, обработанных облучением. с использованием (G) каспазы-3/7 и (H) проточной цитометрии. Данные представлены в виде среднее ± стандартное отклонение. Эксперименты проводились в тройной.**P<0,01 по сравнению с контрольной группой. цирк, кольцевая РНК; миР, микроРНК; HIPK2, белок, взаимодействующий с гомеодоменом киназа; СККМ, мезенхимальные стволовые клетки костного мозга; LC3, легкая цепь 3; RT-qPCR, количественная ПЦР с обратной транскрипцией; ОД, оптический плотность.

    Заглушение circ-016901 ослабляет повреждение клеток, вызванное облучением в СККМ

    СККМ трансфицировали siРНК circ-016901 или siNC до лечения облучением 6 Гр в течение 24 часов. Эффективность трансфекции была подтверждена с помощью RT-qPCR и результаты показали, что siRNA circ-016901 значительно пониженная экспрессия circ-016901 по сравнению с группой siNC (Инжир.2А; Р<0,01). Более того, Анализы CCK-8 показали, что circ-016901 значительно подавляет повышенная пролиферация СККМ, обработанных облучением по сравнению с группой siNC (рис. 2Б; Р<0,05. Circ-016901 миРНК значительно активировала Уровни экспрессии мРНК и белка Beclin-1 и LC3 II/I в облученные СККМ по сравнению с группой siNC (рис. 2C-E; P <0,01). Кроме того, молчание circ-016901 значительно ингибировало апоптоз СККМ, подвергнутые облучению, по сравнению с группой siNC (рис.2F и G; Р<0,01). Подобные результаты были получено при измерении активности каспазы-3/7 (рис. 2H; P<0,01). Эти результаты продемонстрировали, что siРНК circ-016901 способствует пролиферации клеток и аутофагия и ингибирование апоптоза облученных СККМ, что указывает на то, что молчание circ-016901 ослабляло повреждение клеток индуцированных облучением СККМ.

    circ-016901 регулирует ось миР-1249-5p/HIPK2 в СККМ, подвергнутых облучению

    Биоинформатический анализ с использованием онлайн-сервиса Targetscan и базы данных Starbase показали, что miR-1249-5p имеет сайт связывания для circ-016901 (рис.3А и C) и 3′-UTR HIPK2 имел сайт связывания миР-1249-5p (фиг. 3Б). Чтобы выяснить, регулируется ли circ-016901 ось миР-1249-5p/HIPK2 в СККМ, подвергнутых облучению, экспрессия уровни миР-1249-5p и HIPK2 в СККМ, трансфицированных circ-016901 siRNA были обнаружены с помощью RT-qPCR. Результаты продемонстрировали, что молчание circ-016901 значительно активировало экспрессия миР-12249-5p (фиг. 3D; P<0,01) и снижение экспрессии HIPK2 (рис. 3E; P<0,01) по сравнению с siNC группа.Кроме того, вестерн-блоттинг показал, что Сайленсинг circ-016901 снизил экспрессию белка HIPK2 по сравнению с с группой siNC (рис. 3F и Г; Р<0,01). Кроме того, прямая ассоциация-мишень между miR-1249-5p, circ-016901 и HIPK2 был подтвержден с использованием репортерных анализов люциферазы. То Сверхэкспрессия миР-1249-5p значительно снижала относительную люциферазная активность WT-circ-016901 (фиг. 3H) и WT-HIPK2 (фиг. 3I) по сравнению с контрольным миметиком группа. Однако существенных различий между MUT-circ-016901 и MUT-HIPK2 и управляющие имитаторы сверхэкспрессия миР-1249-5p.Эти результаты показали, что circ-016901 регулирует экспрессию miR-1249-5p, и что миР-1249-5p напрямую модулирует экспрессию HIPK2 посредством связывания HIPK2 3'-UTR. Эти результаты свидетельствовали о том, что circ-016901/miR-1249-5p/HIPK2 может представлять собой регуляторный сигнальный путь, участвующий в радиационно-индуцированном поражении СККМ.

    Рисунок 3

    Циркуляр 016901 регламентирует ось миР-1249-5p/HIPK2 в СККМ, подвергнутых облучению. (А) Звездная база предсказал miR-1249-5p в качестве мишени для circ-016901.(Б) Целевое сканирование предсказал HIPK2 как мишень для miR-1249-5p. (C) предсказанная интаРНК miR-1249-5p в качестве мишени для circ-016901. (D) Заглушение Circ-016901 повышенная экспрессия миР-1249-5p. Circ-016901 заглушение снижает уровень экспрессии мРНК (E) и белка (F и G) ХИПК2. (H) Репортерные анализы люциферазы показали, что взаимодействие между circ-016901 и miR-1249-5p. (I) Люцифераза Репортерские анализы показали, что существует взаимодействие между HIPK2 и миР-1249-5p. Данные представлены как среднее ± стандарт. отклонение.Опыты проводили в трехкратной повторности. **P<0,01 по сравнению с группами siNC или контрольными миметиками. Цирк, круговой; миР, микроРНК; HIPK2, HIPK2, взаимодействующие с гомеодоменом протеинкиназа; СККМ, мезенхимальные стволовые клетки костного мозга; си, мелкие мешающие; НК, отрицательный контроль; UTR, нетранслируемая область; WT, дикий тип; МУТ, мутант.

    Глушение HIPK2 имитирует эффекты миР-1249-5p в облученных СККМ

    Для изучения возможной регулирующей роли miR-1249-5p и HIPK2 в оси circ-016901/miR-1249-5p/HIPK2 в облученные СККМ, миметики миР-1249-5p, миРНК HIPK2 и соответствующие контроли (контрольный миметик и siNC соответственно) трансфицируются в СККМ.миР-1249-5p значительно имитирует снижение экспрессии HIPK2 на уровне мРНК (рис. 4А) и белка (рис. 4В) по сравнению с контрольным миметиком группа (Р<0,01). Кроме того, RT-qPCR использовали для проверки эффективность трансфекции сверхэкспрессии миР-1249-5p и HIPK2 молчание. Результаты показали, что сверхэкспрессия миР-1249-5p значительно увеличивала экспрессию миР-1249-5p (рис. 4C; P<0,01), в то время как HIPK2 замалчивал снизил экспрессию HIPK2 (фиг. 4D; Р<0,01). Кроме того, вестерн-блоттинг показал, что Сайленсинг HIPK2 снижал экспрессию белка HIPK2 по сравнению с группа siNC (рис.4Е; Р<0,01). Анализы CCK-8 использовались для определения эффекта миР-1249-5p и HIPK2 на пролиферацию облученных СККМ и результаты показали, что сверхэкспрессия миР-1249-5p и Сайленсинг HIPK2 значительно способствовал пролиферации облученные СККМ по сравнению с их соответствующими контролями (Рис. 4F; P<0,01). Более того, Миметики miR-1249-5p и миРНК HIPK2 эффективно ингибировали апоптоз облученных СККМ по сравнению с контролем группы миметиков и siNC соответственно (рис.4G и Н; Р<0,01). RT-qPCR и вестерн-блоттинг результаты показали, что сверхэкспрессия miR-1249-5p и HIPK2 молчание значительно увеличило экспрессию мРНК и белка уровни LC3 II/I и Beclin-1 по сравнению с контрольным миметиком и группы siNC (рис. 4I и J соответственно; P<0,05), что указывает на что miR-1249-5p и HIPK2 способствуют аутофагии облученные СККМ. Эти результаты продемонстрировали, что ось миР-1249-5p/HIPK2 ослабляла радиационно-индуцированное повреждение СККМ, способствуя пролиферации и аутофагии и ингибируя апоптоз.

    Рисунок 4

    Глушение HIPK2 имитирует эффекты миР-1249-5p в СККМ, подвергнутых облучению. Эффект миР-1249-5p сверхэкспрессия на уровнях экспрессии мРНК (A) и белка (B) HIPK2 был обнаружен с помощью RT-qPCR и вестерн-блоттинга, соответственно. (C) Эффективность трансфекции miR-1249-5p сверхэкспрессию выявляли с помощью RT-qPCR. Эффективность трансфекции молчания HIPK2 на уровне экспрессии мРНК (D) и белка (E) был обнаружен с помощью RT-qPCR и вестерн-блоттинга.(F) Влияние Сверхэкспрессия миР-1249-5p и молчание HIPK2 при пролиферации облученных СККМ измеряли с использованием набора для подсчета клеток-8 пробы. (G и H) Скорость апоптоза индуцированных облучением СККМ. после трансфекции circ-016901 миРНК была обнаружена с использованием проточной цитометрии. Эффект сверхэкспрессии миР-1249-5p и HIPK2 подавление уровня экспрессии мРНК (I) и белка (J) Beclin-1 и LC3-II/I были обнаружены в облученных СККМ. с использованием RT-qPCR и вестерн-блоттинга соответственно.Данные представлены как среднее значение ± стандартное отклонение. Были проведены эксперименты в трех экземплярах. **P<0,01 по сравнению с siNC, ##P<0,01 по сравнению с контрольными группами-имитаторами. ХИПК2, протеинкиназа, взаимодействующая с гомеодоменом; миР, микроРНК; СККМ, кость мезенхимальные стволовые клетки костного мозга; RT-КПЦР, обратный транскрипционно-количественная ПЦР; круг, круговой; си, маленький вмешательство; LC3, легкая цепь 3; НК, отрицательный контроль; ОД, оптический плотность.

    Обсуждение

    При клиническом лечении гематологических злокачественных новообразований, могут быть выполнены аллогенные трансплантации костного мозга и ЧМТ может быть использована для индукции иммуносупрессии для эрадикации злокачественных новообразований. клетки и предотвращают отторжение донорского костного мозга (20).Повреждения, вызванные ЧМТ, связаны с вид облучения, доза и время (58). Клинический выбор облучения может привести к абляции БМ и более тяжелой степени иммуносупрессия, которая может вызвать токсичность, связанную с лечением, и плохой терапевтический эффект (20). Следовательно, радиационно-индуцированное повреждение БМ может быть полезным или вредно в зависимости от процесса применения. Предыдущее исследование продемонстрировали, что длительное подавление BM, вызванное облучением, в первую очередь зависит от остаточных гемопоэтических стволовых клеток и СККМ для восстановления (59).СКСК были Сообщается, что он участвует в процессе репарации опухолевой ткани. после резекции опухоли (60) и опухолевые клетки секретируют различные хемокины, в том числе CCL5 и CCL2 (61,62) для набора СККМ. Более того, лучевая терапия опухолевых тканей может вызвать повреждение СККМ в окружающие ткани опухоли (63). В настоящем исследовании изучалось влияние радиации на мРНК и белковая экспрессия генов, связанных с аутофагией, и результаты продемонстрировали, что уровень мРНК и белка Беклина-1 был значительно снижалась дозозависимым образом, что указывало на что радиация может вызвать аутофагию в СККМ.Кроме того, LC3-II и уровни экспрессии LC3-I были снижены в ответ на облучение; однако существенной разницы между соотношение LC3-II/LC-I. Механизм, лежащий в основе этого явления остается неизвестным. Необходимы дополнительные исследования для выяснения этот механизм. Кроме того, предварительное исследование показало, что облучение повышало экспрессию circ-016901 и HIPK2 в СККМ и снижение экспрессии миР-1249-5p. Замалчивание circ-016901 ослаблял повреждение СККМ, индуцированных облучением, за счет регулирующие ось miR-1249-5p/HIPK2.

    Недавнее исследование показало, что circ-016901 является активируется в СККМ, обработанных облучением (34). Однако, в меру нашего известно, никаких других исследований по этому поводу не поступало новая циркРНК. В настоящем исследовании лечение облучением значительно увеличивал экспрессию circ-016901. Кроме того, молчание circ-016901 способствовало пролиферации и аутофагии и ингибирует апоптоз в СККМ, подвергнутых облучению. Предыдущие исследования показали, что кольцевые РНК служат конкурирующими эндогенные РНК для адсорбции микроРНК и регуляции экспрессии мРНК целевого гена (64,65).Поэтому настоящее исследование было сосредоточено на конкурирующем эндогенном механизме circ-016901, т.е. участвует в радиационно-индуцированном повреждении СККМ. онлайн биоинформатический анализ показал, что miR-1249-5p является связующим держатель для circ-016901 и HIPK2. Репортерные анализы люциферазы дополнительно подтверждено, что circ-016901 и HIPK2 могут связывать miR-1249-5p в БМСК. Чтобы исследовать роль miR-1249-5p в облученных СККМ, функциональные анализы miR-1249-5p были выполненный. Результаты показали, что сверхэкспрессия миР-1249-5p значительно способствует пролиферации и аутофагии и ингибирует апоптоз; эти результаты были аналогичны результатам, полученным в circ-016901 заглушение.Примечательно, что предыдущее исследование колоректального линии раковых клеток сообщили, что защитная роль miR-1249-5p противоречило ингибирующему эффекту миР-1249. гиперэкспрессия (43), в то время как позитивная регуляторная роль миР-1249 в отношении пролиферации глиомы клеточная линия (66) была похожа на текущие результаты. Эти противоположные регуляторные функции миР-1249 может быть связано со сложностью и различиями физиологических регуляторные сети различных клеточных линий или физиологические или патологический статус.

    Предыдущие исследования показали, что HIPK2 может представляют собой потенциальный супрессор опухоли, который ингибирует рост опухоли и повысить чувствительность к лекарствам, регулируя определенные ключевые молекулярные пути, включая р53-независимые пути апоптоза и Путь индуцируемого гипоксией фактора 1α (HIF-1α) в опухолевых клетках (67,68). Исследования показали, что HIPK2 индуцирует апоптоз зависимым или независимым образом через ген р53 (69). Фосфорилирование в положение 46 р53 активирует экспрессию отрицательного регулятор р53, тем самым направляя клетки на репарацию ДНК или апоптоз торможение (53), заставляя замолчать HIPK2 снижает апоптоз (70).То текущее исследование показало, что сверхэкспрессия miR-1249-5p значительно снижает экспрессию HIPK2. Более того, Сайленсинг HIPK2 способствует пролиферации и аутофагии и ингибирует апоптоз, который имитировал защитные эффекты миР-1249-5p сверхэкспрессия в СККМ, подвергнутых облучению. Эти результаты подтвердили, что ось miR-1249-5p/HIPK2 участвует в circ-016901-опосредованное радиационное повреждение СККМ. Тем не мение, эффекты circRNA-016901 на некоторые важные маркеры для дифференцировка остеобластов, включая щелочную фосфатазу (ЩФ), коллаж 1 (ConI), остеокальцин (OCN), остеопонтин (OPN) и Связанный с рантом транскрипционный фактор 2 (RUNX2) не исследовался.Поэтому необходимы дальнейшие исследования для выявления роли circRNA-016901 в регуляции этих генов.

    Таким образом, настоящее исследование показало, что circ-016901 ослаблял повреждение в индуцированных облучением СККМ мышей посредством регуляции оси miR-1249-5p/HIPK2. То circRNA-016901/miR-1249-5p/HIPK2 может играть решающую роль в защита СККМ от радиационного поражения. Эти результаты указывали на новый механизм регуляции радиационного стресса СККМ и др. выяснили молекулярные механизмы радиобиологических эффектов.Будущие исследования, связанные с ролью circRNA-016901 в регуляция маркеров дифференцировки остеобластов (ALP, ConI, OCN, OPN и RUNX2) будут проводиться для расследования эффективного лечение радиационных повреждений СККМ.

    Благодарности

    Не применимо.

    Финансирование

    Финансирование: Настоящее исследование было поддержано Hunan Natural Научный фонд (грант № 2018JJ3791), Национальный природный Научный фонд Китая (гранты № 81602801 и 81573091), Фонд естественных наук провинции Хунань (грант No.2019JJ50909) и исследовательский проект Hunan Health and Family Комиссия по планированию (грант № B2017100).

    Наличие данных и материалов

    Все данные, сгенерированные или проанализированные в ходе этого исследования, включены в эту опубликованную статью.

    Вклад авторов

    WY, RG и XN проанализировали и интерпретировали данные. ДС, RH и HD провели эксперименты. XW написал рукопись и интерпретировал данные. JZ внесла свой вклад в разработку дизайна исследования. Все авторы прочитали и одобрили окончательный вариант рукописи.

    Одобрение этики и согласие на участвовать

    Исследования на животных проводились в соответствии с Хельсинкская декларация и одобренная институциональная этика Комитет Третьей больницы Сянъя Центрального Юга Университет, Хунань, Китай (разрешение № 2019-S534).

    Согласие пациента на публикацию

    Не применимо.

    Конкурирующие интересы

    Авторы заявляют, что у них нет конкурирующих интересы.

    Каталожные номера

    1

    Бергер Дж.М., Сингх П., Хримиан Л., Морган Д.А., Чоудхури С., Артеага-Солис Э., Хорват Т.Л., Домингос А.И., Марсленд А.Л., Ядав В.К. и др.: Опосредование реакции на острый стресс Скелет.Клеточный метаб. 30:890–902.e8. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    2

    Хаяси М., Накашима Т., Йошимура Н., Окамото К., Танака С. и Такаянаги Х.: Саморегуляция остеоцитов Sema3A управляет действием эстрогена и противодействует старению костей. Клеточный метаб. 29:627–637.e5. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    3

    Рен Р., Окампо А., Лю Г.Х. и Изписуа Belmonte JC: Регуляция старения стволовых клеток посредством метаболизма и эпигенетика.Клеточный метаб. 26:460–474. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    4

    Fan Y, Hanai JI, Le PT, Bi R, Maridas D, ДеМамбро В., Фигероа К.А., Кир С., Чжоу Х., Маннштадт М. и др.: Паратгормон управляет судьбой мезенхимальных клеток костного мозга. Клетка Метаб. 25:661–672. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    5

    Стеген С., ван Гастел Н., Илен Г., Гескьер Б., Д’Анна Ф., Тиенпон Б., Говейя Дж., Торрекенс С., Ван Looveren R, Luyten FP и др.: HIF-1α способствует опосредованному глутамином окислительно-восстановительный гомеостаз и гликогензависимая биоэнергетика для поддержания постимплантационная выживаемость костных клеток.Клеточный метаб. 23: 265–279. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    6

    Li CJ, Xiao Y, Yang M, Su T, Sun X, Guo Q, Huang Y и Luo XH: Длинная некодирующая РНК Bmncr регулирует мезенхимальные клетки. Судьба стволовых клеток при старении скелета. Джей Клин Инвест. 128: 5251–5266. 2018. Просмотр PubMed/NCBI Статья : Академия Google

    7

    Li CJ, Cheng P, Liang MK, Chen YS, Lu Q, Wang JY, Xia ZY, Zhou HD, Cao X, Xie H и др.: MicroRNA-188 регулирует возрастное переключение между остеобластами и адипоцитами дифференциация.Джей Клин Инвест. 125: 1509–1522. 2015. Просмотр PubMed/NCBI Статья : Академия Google

    8

    Ю И, Ньюман Х, Шен Л, Шарма Д, Ху Г, Мирандо А.Дж., Чжан Х., Кнудсен Э., Чжан Г.Ф., Хилтон М.Дж. и др.: Метаболизм глютамина регулирует пролиферацию и распределение по клонам в скелетных стволовых клетках. Клеточный метаб. 29:966–978.e4. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    9

    Коде А, Мосиалоу И, Манавалан С.Дж., Ратинам CV, Фридман Р.А., Теруя-Фельдштейн Дж., Бхагат Г., Берман Э. и Кустени С.: FoxO1-зависимая индукция острого миелоидного лейкоза остеобласты у мышей.Лейкемия. 30:1–13. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    10

    Raaijmakers MHGP, Мукерджи С., Го С., Чжан С., Кобаяши Т., Шунмейкер Дж. А., Эберт Б. Л., Аль-Шахрур Ф., Hasserjian RP, Scadden EO и др.: Дисфункция предшественников костей вызывает миелодисплазию и вторичный лейкоз. Природа. 464: 852–857. 2010. PubMed/NCBI Просмотр статьи: Google Scholar

    11

    Гипо О., Жайе С., Клеман-Кольму К., Франсуа А., Супио С. и Милья Ф.: Важность сосудистой эндотелиальный барьер при иммуновоспалительном ответе, индуцированном лучевая терапия.Бр Дж Радиол. 91:20170762. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    12

    Lee H, Li C, Zhang Y, Zhang D, Otterbein LE и Jin Y: Кавеолин-1 избирательно регулирует сортировку микроРНК в микровезикулы после вредных раздражителей. J Эксперт Мед. 216:2202–2220. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    13

    Сингх П.Б., Пуа Х.Х., Хапп Х.К., Шнайдер С., фон Мольтке Дж., Локсли Р.М., Баумйоханн Д. и Ансель К.М.: микроРНК регуляция гомеостаза и функции врожденных лимфоидных клеток 2 типа при аллергическом воспалении.J Эксперт Мед. 214:3627–3643. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    14

    Лю И, Ван Н, Чжан С и Лян Ц: Аутофагия защищает мезенхимальные стволовые клетки костного мозга от индуцированный пальмитатом апоптоз посредством передачи сигналов ROS-JNK/p38 MAPK пути. Mol Med Rep. 18:1485–1494. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    15

    Брудно Дж. Н., Марич И., Хартман С. Д., Роуз Дж. Дж., Ван М., Лам Н., Стетлер-Стивенсон М., Салем Д., Юань С., Павлетич С. и др. al: Т-клетки, генетически модифицированные для экспрессии анти-В-клеток созревание антигена химерного антигенного рецептора вызывают ремиссии рецидивирующая множественная миелома с плохим прогнозом.Дж. Клин Онкол. 36:2267–2280. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    16

    Черепаха CJ, Hay KA, Hanafi LA, Li D, Чериан С., Чен Х., Вуд Б., Лозански А., Берд Дж. К., Хеймфельд С. и др.: Стойкие молекулярные ремиссии при хроническом лимфолейкозе обработанный CD19-специфическим химерным антигенным рецептором, модифицированным T клеток после неэффективности ибрутиниба. Дж. Клин Онкол. 35:3010–3020. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    17

    Чжан Л., Ян Ф. и Фэн С.: Аллогенные трансплантация гемопоэтических стволовых клеток при миелофиброзе.Тер Ад Гематол. 11:2040620720

    2. 2020. PubMed/NCBI Просмотр статьи: Google Scholar

    18

    Гарсия-Гарсия А, де Кастильехо CL и Мендес-Феррер С.: СККМ и гемопоэз. Иммунол Летт. 168:129–135. 2015. PubMed/NCBI Просмотр статьи: Google Scholar

    19

    Дамек-Поправа М., Стефаник Д., Левин Л.М. и Акинтой С.О.: Стромальные клетки костного мозга человека отображают переменную ответ, зависящий от анатомического участка, и восстановление после облучения.Arch Oral Biol. 55:358–364. 2010. PubMed/NCBI Просмотр статьи: Google Scholar

    20

    Паикс А., Антони Д., Вайси В., Леду М.П., Билгер К., Форнекер Л. и Ноэль Г.: Общее облучение тела в режимы кондиционирования при аллогенной трансплантации костного мозга: A обзор. Crit Rev Oncol Hematol. 123:138–148. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    21

    Лукас Д.: Микроокружение костного мозга для гемопоэтических стволовых клеток.Adv Exp Med Biol. 1041: 5–18. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    22

    Ле И, Фрейно С., Чандран П., Саблофф М., Бренд М, Лавуа Дж. Р., Ганье Р., Розу-Майлс М., Яук С. Л., Ричардсон Р. Б., и др.: Адипогенные мезенхимальные стромальные клетки костного мозга и их поддерживающая гемопоэтическая роль: к пониманию Пермиссивное микроокружение костного мозга при остром миелоидном лейкозе. Корень Cell Rev Rep. 12: 235–244. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    23

    Лю Зи, Чжан И, Сяо Х, Яо Зи, Чжан Х, Liu Q, Wu B, Nie D, Li Y, Pang Y и др.: Котрансплантация кости мезенхимальные стволовые клетки костного мозга в гаплоидентичных трансплантацию гемопоэтических стволовых клеток у пациентов с тяжелым апластическая анемия: промежуточный итог многоцентрового исследования фазы II результаты испытаний.Пересадка костного мозга. 52:704–710. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    24

    Ригер К., Маринец О., Фитц Т., Кёрпер С., Sommer D, Mücke C, Reufi B, Blau WI, Thiel E и Knauf WU: Мезенхимальные стволовые клетки остаются клетками хозяина даже в течение длительного времени после аллогенные стволовые клетки периферической крови или костный мозг трансплантация. эксп Гематол. 33:605–611. 2005. PubMed/NCBI Просмотр статьи: Google Scholar

    25

    Ву К.Х., Ву Х.П., Чан К.К., Хван С.М., Пэн К.Т. и Chao YH: Роль мезенхимальных стволовых клеток в гемопоэзе. трансплантация стволовых клеток: от скамейки до прикроватных тумбочек.Трансплантация клеток. 22:723–729. 2013. PubMed/NCBI Просмотр статьи: Google Scholar

    26

    Херберг С., Ши С., Джонсон М. Х., Хэмрик М. В., Исалес К.М. и Хилл В.Д.: Фактор-1β, полученный из стромальных клеток, опосредует клетку выживаемость за счет усиления аутофагии в клетках костного мозга мезенхимальные стволовые клетки. ПЛОС Один. 8(e58207)2013. PubMed/NCBI Посмотреть статью : Google Scholar

    27

    Франсуа С., Бенсидум М., Муиседдин М., Мазурье С., Аллене Б., Семон А., Фрик Дж., Саше А., Буше С., Тьерри Д. и др.: Локальное облучение не только вызывает самонаведение мезенхимальные стволовые клетки человека на открытых участках, но способствует их распространенное приживление к нескольким органам: исследование их количественное распределение после радиационного повреждения.Стволовые клетки. 24:1020–1029. 2006. PubMed/NCBI Посмотреть статью: Google Scholar

    28

    Муйзеддин М., Франсуа С., Семон А., Саш A, Allenet B, Mathieu N, Frick J, Thierry D и Chapel A: Human мезенхимальные стволовые клетки являются домом специально для радиационно-поврежденных ткани при сахарном диабете без ожирения/тяжелом комбинированном иммунодефиците модель мыши. Бр Дж Радиол. 80:С49–С55. 2007. PubMed/NCBI Просмотр статьи: Google Scholar

    29

    Херберг С., Кондрикова Г., Хусейн К.А., Периясами-Тандаван С., Джонсон М.Х., Эльсаланти М.Е., Ши Х., Хамрик MW, Isales CM и Hill WD: Общее облучение тела допустимо для образование новой кости, опосредованное мезенхимальными стволовыми клетками, после локального трансплантация.Tissue Eng, часть A. 20: 3212–3227. 2014. PubMed/NCBI Просмотр статьи: Google Scholar

    30

    Джек В. Р., Соррентино Дж. А., Ван К., Слевин М. К., Burd CE, Liu J, Marzluff WF и Sharpless NE: кольцевые РНК обильные, консервативные и связанные с повторами ALU. РНК. 19: 141–157. 2013. PubMed/NCBI Просмотр статьи: Google Scholar

    31

    Флорис Г., Чжан Л., Фоллеса П. и Сун Т.: Регуляторная роль кольцевых РНК и неврологические расстройства.Мол Нейробиол. 54:5156–5165. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    32

    Цзян Г, Ма И, Ан Т, Пан И, Мо Ф, Чжао Д, Liu Y, Miao JN, Gu YJ, Wang Y и др.: Отношения кольцевой РНК при диабете и депрессии. Sci Rep. 7(7285)2017.PubMed/NCBI View Article : Google Scholar

    33

    Мэн С., Чжоу Х., Фэн З., Сюй З., Тан Ю., Ли П. и Wu M: ЦиркРНК: функции и свойства нового потенциала биомаркер рака.Мол Рак. 16(94)2017. PubMed/NCBI Просмотр статьи: Google Scholar

    34

    Чжан Дж., Цзян Дж., Хуан Р., Ван И, Не Икс и Gui R: Профили экспрессии кольцевой РНК значительно изменены у мышей стромальные клетки костного мозга после всего тела облучение. Лейк Рез. 70:67–73. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    35

    Балага О., Фридман Ю. и Линиал М.: Навстречу комбинаторный характер регуляции микроРНК в клетках человека.Нуклеиновые Кислоты Res. 40:9404–9416. 2012. PubMed/NCBI Просмотр статьи: Google Scholar

    36

    Мусави С.Р., Ахмади А., Джамалканди С.А. и Салимиан Дж.: Участие микроРНК в физиологических и патологические процессы при бронхиальной астме. J Cell Physiol. 234:21547–21559. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    37

    Danka Mohammed CP, Park JS, Nam HG и Kim K: МикроРНК при старении мозга.Механическое старение Dev. 168:3–9. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    38

    Ни Дж., Буччи Дж., Чанг Л., Малуф Д., Грэм П. и Li Y: Ориентация на микроРНК при лучевой терапии рака предстательной железы. Тераностика. 7:3243–3259. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    39

    Bartel DP: МикроРНК: распознавание мишени и регулирующие функции. Клетка. 136: 215–233. 2009.PubMed/NCBI View Article : Google Scholar

    40

    Lai EC: микроРНК комплементарны 3′ Мотивы последовательности UTR, которые опосредуют негативные посттранскрипционные регулирование. Нат Жене. 30:363–364. 2002. Просмотр PubMed/NCBI. Статья : Академия Google

    41

    Sayed D и Abdellatif M: МикроРНК в развития и болезни. Physiol Rev. 91: 827–887. 2011. PubMed/NCBI Просмотр статьи: Google Scholar

    42

    Liu KX, Chen GP, ​​Lin PL, Huang JC, Lin X, Qi JC и Lin QC: Обнаружение и анализ апоптоза и связанные с аутофагией микроРНК эндотелиальных клеток сосудов мыши в Модель хронической перемежающейся гипоксии.Жизнь наук. 193:194–199. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    43

    Чен Х, Цзэн К, Сюй М, Лю Х, Ху Х, Сюй Т, He B, Pan Y, Sun H и Wang S: миР-1249, индуцированная P53, ингибирует опухоль рост, метастазирование и ангиогенез путем нацеливания на VEGFA и HMGA2. Клеточная смерть Дис. 10(131)2019. PubMed/NCBI Просмотр статьи: Google Scholar

    44

    Yan L, Li J, Wu Q и Chen L: Конкретно Профиль экспрессии микроРНК в сыворотке крови при миксоме сердца пациенты.Онкол Летт. 16:4235–4242. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    45

    Йоши С., Хаяши Ю., Иидзима Х., Иноуэ Т., Кимура К., Сакатани А., Нагай К., Фуджинага Т., Хияма С., Кодама Т. и др. al: Экзосомальные микроРНК, полученные из клеток рака толстой кишки, способствуют прогрессирование опухоли путем подавления экспрессии TP53 фибробластами. Рак науч. 110:2396–2407. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    46

    Seshachalam VP, Sekar K и Hui KM: Взгляд на регуляторные сети генов, связанных с этиологией, у гепатоцеллюлярная карцинома из Атласа генома рака.Дж Гастроэнтерол Гепатол. 33:2037–2047. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    47

    Кульчески Ф.Р., Кристофф А.П. и Маргис Р.: Кольцевые РНК представляют собой губки миРНК и могут использоваться в качестве нового класса биомаркер. Дж Биотехнолог. 238:42–51. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    48

    Родригес-Хил А., Риттер О., Хорнунг Дж., Стекман Х., Крюгер М., Браун Т., Креммер Э., Крахт М. и Шмитц М.Л.: Киназы семейства HIPK связывают и регулируют функцию CCR4-NOT. сложный.Мол Биол Селл. 27:1969–1980. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    49

    Кувано Ю, Нисида К, Акаике Ю, Курокава К, Нишикава Т., Масуда К. и Рокутан К.: Взаимодействие с гомеодоменом протеинкиназа-2: критический регулятор реакции на повреждение ДНК и эпигеном. Int J Mol Sci. 17(1638)2016. PubMed/NCBI Посмотреть статью : Google Scholar

    50

    Хашимото К. и Цудзи Ю.: Вызванные мышьяком активация протеинкиназы 2, взаимодействующей с гомеодоменом (HIPK2) к оси белка, связывающего цАМФ-ответный элемент (CREB).Дж Мол Биол. 429:64–78. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    51

    Kwon MJ, Min SK, Seo J, Kim DH, Sung CO, Лим М.С., Чо Дж. и Парк Х.Р.: экспрессия HIPK2 при прогрессировании эпителиальное новообразование кожи. Int J Дерматол. 54:347–354. 2015. PubMed/NCBI Просмотр статьи: Google Scholar

    52

    Zhang Z, Wen P, Li F, Yao C, Wang T, Liang B, Yang Q, Ma L и He L: HIPK2 ингибирует метастазирование клеток и улучшает химиочувствительность при плоскоклеточном раке пищевода.Эксперт Тер Мед. 15:1113–1118. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    53

    Fan Y, Wang N, Chuang P и He JC: роль HIPK2 при фиброзе почек. Приложение Kidney Int, 2011. 4:97–101. 2014. PubMed/NCBI Просмотр статьи: Google Scholar

    54

    Д’Орази Г., Чеккинелли Б., Бруно Т., Манни Я, Хигасимото Ю., Сайто С., Гостисса М., Коэн С., Марчетти А., Дель Сал G и др.: Фосфорилаты протеинкиназы-2, взаимодействующие с гомеодоменом. p53 в Ser 46 и опосредует апоптоз.Nat Cell Biol. 4:11–19. 2002. Просмотр PubMed/NCBI. Статья : Академия Google

    55

    Моффит А.Д., Бриньоло Л.Л., Ардешир А. и Кример-Хенте М.А.: Роль эмоционального заражения в дистрессе проявляется у сгруппированных мышей, подвергшихся воздействию CO 2 . Лаборатория J Am Assoc Аним Науки. 58:430–437. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    56

    Доминики М., Ле Блан К., Мюллер И., Слапер-Кортенбах И., Марини Ф., Краузе Д., Динс Р., Китинг А., Prockop Dj и Horwitz E: минимальные критерии для определения мультипотентности мезенхимальные стромальные клетки.Международное общество сотовой связи Заявление о позиции терапии. Цитотерапия. 8: 315–317. 2006. PubMed/NCBI Посмотреть статью: Google Scholar

    57

    Вагнер Э.М.: Мониторинг экспрессии генов: Количественная RT-PCR в реальном времени. Методы Мол Биол. 1027: 19–45. 2013. PubMed/NCBI Просмотр статьи: Google Scholar

    58

    Уилке С., Холтан С.Г., Шарки Л., ДеФор Т., Арора М., Премакантан П., Йохе С., Вагге С., Чжоу Д., Холтер Чакрабарти Дж. Л. и др.: Повреждение костного мозга и восстановление кроветворения после аллогенной трансплантации костного мозга по поводу острого лейкозы: влияние дозы облучения и режима кондиционирования.Радиотер Онкол. 118:65–71. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    59

    Чжоу Дж., Панг Х., Ли В., Лю К., Сюй Л., Лю К. и Liu Y: Влияние полисахаридов Lycium barbarum на апоптоз, клеточная адгезия и окислительное повреждение в костном мозге мононуклеарные клетки мышей, подвергшихся поражению ионизирующим излучением. Биомед Рез Инт. 2016: 1–8. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    60

    Hang HL и Xia Q: роль СККМ в печени регенерация и метастазирование после гепатэктомии.Мир J Гастроэнтерол. 20:126–132. 2014. PubMed/NCBI Просмотр статьи: Google Scholar

    61

    Ли И, Чжэн И, Ли Т, Ван Ц, Цянь Дж, Лу И, Чжан М., Би Э., Ян М., Реу Ф. и др.: Хемокины CCL2, 3, 14 стимулировать возвращение макрофагов в костный мозг, пролиферацию и поляризация при множественной миеломе. Онкотаргет. 6:24218–24229. 2015. PubMed/NCBI Просмотр статьи: Google Scholar

    62

    Чен Р., Ли WY-W, Чжан XH, Чжан Дж. Т., Лин S, Xu LL, Huang B, Yang FY, Liu HL, Wang B и др.: Эпигенетические модификация оси CCL5/CCR1/ERK улучшает нацеливание на глиому в дедифференцировочно-перепрограммированные СККМ.Отчеты о стволовых клетках. 8: 743–757. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    63

    Чжан Дж, Цю Х, Си К, Ху В, Пей Х, Ни Дж, Ван З., Дин Дж., Шан П., Ли Б. и др.: Терапевтическая ионизация Радиационно-индуцированная потеря костной массы: обзор in vivo и in vitro результаты. Подключить тканевый рез. 59: 509–522. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    64

    Ронг Д, Сунь Х, Ли Зи, Лю С, Донг С, Фу К, Tang W и Cao H: новая функция оси circRNA-miRNAs-mRNA при заболеваниях человека.Онкотаргет. 8:73271–73281. 2017. PubMed/NCBI Посмотреть статью: Google Scholar

    65

    Li G, Huang M, Cai Y, Yang Y, Sun X и Ke Y: Circ-U2AF1 способствует развитию глиомы человека посредством дерепрессии нейроонкологический вентральный антиген 2 с помощью губки hsa-miR-7-5p. Дж Клеточная физиол. 234:9144–9155. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    66

    Fang B и Li G, Xu C, Hui Y и Li G: МикроРНК миР-1249 подавляет аденоматозный полипоз толстой кишки 2 экспрессии и способствует пролиферации клеток глиомы.Am J Перевод Рез. 10:1324–1336. 2018. PubMed/NCBI

    67

    Ли С., Шан Ю., Редмонд С. А., Урисман А., Танг А.А., Ли К.Х., Бурлингейм А.Л., Пак Р.А., Йовичич А., Гитлер А.Д. и др.: Активация HIPK2 способствует стресс-опосредованной нейродегенерации ER. при боковом амиотрофическом склерозе. Нейрон. 91:41–55. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    68

    Линь Дж., Чжан Ц., Лу Ю., Сюэ В., Сюй Ю., Чжу Ю. и Hu X: подавление HIPK2 повышает резистентность мочевого пузыря. раковой клетки к цисплатину, регулируя Wip1.ПЛОС Один. 9(e98418)2014.PubMed/NCBI Посмотреть статью : Google Scholar

    69

    Манчини Ф., Пьерони Л., Монтелеоне В., Лука Р., Фичи Л., Лука Э., Урбани А., Сюн С., Содду С., Масетти Р. и др.: Цитоплазматическая сборка MDM4/HIPK2/p53 обнаруживает скоординированную репрессию молекул с антиапоптотической активностью при раннем повреждении ДНК отклик. Онкоген. 35:228–240. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    70

    Чжао Ю.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *