Мкк 6 02: Корнеуборочная машина монтируемая МКК-6-02: сравнить цены, купить в Краснодаре, Ростове-на-Дону, Крыму и Ставрополе

alexxlab | 11.12.1974 | 0 | Разное

Содержание

Производительная машина для уборки сахарной свеклы МКК-6-02

Главная | Обзоры сайта vipparts.ru | Производительная машина для уборки сахарной свеклы МКК-6-02Мы имеем необходимый технический потенциал, чтобы предоставлять длительный гарантийный срок на сельскохозяйственную технику, имеющуюся у нас в наличии. Наши специалисты готовы в любое время отправиться по вашему вызову и выполнить весь спектр мероприятий, предусмотренных гарантийным обслуживанием.

Производительная машина для уборки сахарной свеклы МКК-6-02 с доставкой покупателю будет получена заказчиком строго в установленные сроки. Вам не придётся долго ждать, так как все наши структуры работают бесперебойно и профессионально. На каждом этапе оформления заказа и доставки с вами будут работать квалифицированные специалисты.

Оптимальные технические возможности и низкая цена на машину для уборки сахарной свеклы МКК-6-02 позволят вам приобрести надёжного помощника, активно работающего в области сельского хозяйства. Машина имеет основную раму с корнесобирательной конструкцией, и данное приспособление смодулировано с трактором определённой мощности. Мы приветствуем ваше желание купить машина для уборки сахарной свеклы МКК-6-02, так как то действительно функциональное оборудование с мостом управляемых колёс и механизмом задней зацепки. В конструкцию также входят конвейеры, выгрузочный элеватор и механизм рулевого управления. Также есть система сигнализации и контроля за всеми текущими процессами.

Дата публикации: 29 марта 2016 г.

Смотрите так же

Для человека, не задумывающегося о покупке автомобиля, термины «лизинг» и «трейд-ин» не скажут ровным счетом ничего

Концерн Aston Martin представил миру свое новое творение под названием Aston Martin V8 Zagato. Нужно отметить, что двух дверное купе достаточно быстро привлекло внимание автолюбителей, ведь для 1986 года выпуска, агрегат просто превзошел все ожидания.

Современный сверхмощный автомобиль Aston Martin DB9 Coupe изготовлен на на заводе Aston Martin и благодаря своим техническим возможностям получил соответствующее название

Каталог деталей МКК-6 Издательство Украгрозапчасть

Каталог деталей Машина корнеуборочная МКК-6

и модификации (МКК-6-01, МКК-6-02, МКК-6-03, МКК-6-04, МКК-6-05)

КАК ПОЛЬЗОВАТЬСЯ КАТАЛОГОМ
СБОРОЧНЫЕ ЕДИНИЦЫ И ДЕТАЛИ
Рама МКК 010000
Подвеска РКС6.01610
Задний мост РКС6.02000
Механизм рулевого управления МКК 02000
Трансмиссия МКК 03000
Шнековый транспортер МКК 05000
Транспортер продольный МКК 06000
Транспортер поперечный МКК 07000
Рама нижняя МКК 08010
Рама средняя РКР 19030
Рама верхняя РКР 19150
Блок звездочек погрузочного транспортера МКК 08000
Полотно пруткового транспортера РКР 19160
Электрооборудование МКК 10000
Автомат вождения по рядкам МКК 14000
Копир-рыхлитель КС6-16140
Щитки и ограждения МКК 09000
Система автоконтроля МКК 15000

Система автоконтроля МКК 17000
Гидросистема МКК 18000 (передняя часть)
Гидросистема МКК 18000 (задняя часть)
Золотник управляемых колес
Автомат вождения по рядкам РКС6.04000
Копир полозковый РКГ01230
Кронштейн средний РКС6.04090
Тяга поперечная в сборе РКС6.04110
Штанга верхняя в сборе КС6.16160
Штанга нижняя в сборе КС6.16170
Кронштейн поворотный в сборе КС6.16650
Копатель МКК 23000, МКК 23000-01
Бичи РКР04240, РКР04240-01
Механизм привода вилок РКС6.03140-02
Механизм привода вилок РКС6.03140-01
Механизм привода вилок РКС6.03140
Механизм привода вилок РКС6.03140-03
Механизм привода вилок РКС6.03140-05
Соединение механизмов привода вилок
Соединение механизмов приводов корнезаборников
Бичи МКК 24060, МКК 24060-01
Корнезаборники РКР04230, РКР04230-01
Натяжное устройство цепного привода корнезаборников
Вал привода РКР04160, РКР04160-01
Ступица в сборе РКС6.10070
Вал ведущий РКС6.11880
Копатель МКК 24000, МКК 24000-01
Корнезаборники РКС6.35000-02, РКС6.35000-03
Передний мост РКГ11000
Копач дисковый РКС6.65180
Полотно приемного транспортера РКС6.65240
Приемный транспортер РКС6.65010, РКС6.65010-01
Вал ведущий РКС6.65130
Вал битерный РКС6.65140, РКС6.65140-01
Вал кулачковый РКС6.65150
Вал кулачковый РКС6.65160, РКС6.65160-01
Вал ведомый РКС6.65170
Ролик натяжной РКС6.65230

 

Ведущий вал Машина корнеуборочная МКК-6 и модификации (МКК-6-01, МКК-6-02, МКК-6-03, МКК-6-04, МКК-6-05)

Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А - Деловой мир

МКК-14.000 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А АВТОМАТ ВОЖДЕНИЯ
РКС-6.11.880 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БИТЕР В СБОРЕ (ВАЛ 6-ТИ ЛОПАСТНОЙ) РКС-6
СПС 16.020А Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БИТЕР ВАЛ (ШНЕК) ШНЕКОВОГО ТР-РА(БЕЗ ЗВЕЗД)
РКС-6.11.910 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БИТЕР КОПАЧА
РКС-6.11.870-01 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БИТЕР КОПАЧА (ВАЛ 4-Х ЛОПАСТНЫЙ В СБОРЕ ЛЕВЫЙ.)
РКС-6.11.870 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БИТЕР КОПАЧА (ВАЛ 4-Х ЛОПАСТНЫЙ В СБОРЕ ПРАВ.)
СПС 19.240А Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БИТЕР РАСПРЕД-НЫЙ(АКТИВ.) РАССРЕДОТОЧИТЕЛЯ(БЕЗ ЗВЕЗД)
СПС 18.100-02 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А Блок звёздочек (z=18/32 d=72 t=25.4) РКМ и МКК
КТ 22.603 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БЛОК ЗВЕЗДОЧЕК Z=14/14
СПС 08.634 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БЛОК ЗВЕЗДОЧЕК Z=15/15,Т=25,4 РАЗДАТОЧНОГО ВАЛА Д=42
СПС 08.639 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БЛОК ЗВЕЗДОЧЕК Z=15/15,Т=25,Д=72 СИЛОВОЙ
СПС 08.540 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БЛОК ЗВЕЗДОЧЕК Z=15/20,Т=25,4 РЕДУКТОРА ТРАНСМИССИИ
РКС 6.08.150 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БЛОК ЗВЕЗДОЧЕК Z=18
СПС 08.635 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БЛОК ЗВЕЗДОЧЕК Z=18/18 ПРОД. ВАЛА ТРАНСМ. СПС-4,2А
СПС 18.230 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БЛОК ЗВЕЗДОЧЕК В СБОРЕ(Z=18/25) ВЫГРУЗН. ТР-РА СПС-4,2
СПС 08.480 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А БЛОК ЗВЕЗДОЧЕК( Z=18/32) В СБОРЕ
СПС 30.607-01 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ
СПС 30.606 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ
СПС 30.607 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ
МКК 23.302 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ (КРЕСТОВИНА) ПРИВОДА ВИЛОК (РКС-6.11.960)
СПС 08.650 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ (ЛЕВЫЙ) В СБОРЕ
СПС 08.640 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ (ПРАВЫЙ) В СБОРЕ
РКС-6.65.160 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ 2-Й КУЛАЧ. ДИСК. КОПАТЕЛЯ (ПРАВ.МКК-6,РКМ-6-03)
РКС-6.65.160-01 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ 2-Й КУЛАЧКОВЫЙ (ЛЕВОГО ДИСКОВОГО КОПАЧА) МКК-6
РКС-6.11.682 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ 4-Х ЛОПАСТНОЙ (1 ШПОНКА)
РКС-6.11.681 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ 4-Х ЛОПАСТНОЙ (2 ШПОНКИ)
РКС-6.07.130 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ВЕД. В СБ. ВЫГР. ТР-РА РКС-6,МКК-6.02,РКМ-6.01
РКС-6.07.605 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ВЕДУЩ.ТР-РОВ (L=1,248 С 89Г)
СПС 30.210 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ КУЛАЧКОВЫЙ (ШНЕК) ПИТАТЕЛЯ СПС-4,2
СПС 08.663 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ЛЕВЫЙ (1 ШПОНКА)
СПС 08.664 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРАВЫЙ ТРАНСМИССИИ ПИТАТЕЛЯ СПС-4,2А
РКР 04.616 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРИВОДА КОПАТЕЛЯ
СПС 16.622 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРИВОДА ПРИЕМНОГО ШНЕКА РАССРЕДОТОЧИТЕЛЯ
СПС 16.618 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРИВОДА ШНЕКОВ
СПС 08.620 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРОДОЛЬНЫЙ В СБОРЕ
СПС 08.662 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРОДОЛЬНЫЙ ТРАНСМИССИИ ПИТАТЕЛЯ
РКР 03.100 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРОМЕЖУТ. В СБ.
РКР 03.616 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРОМЕЖУТОЧНЫЙ НЕ В СБОРЕ РКМ-6-01, МКК-6-02
РКР 03.661 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ПРОМЕЖУТОЧНЫЙ ЦЕНТРАЛЬНОГО РЕДУКТОРА РКМ-6
СПС 08.630 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ РАЗДАТОЧНЫЙ
РКС-6.03.647 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ РЕДУКТОРА ВИЛОК
РКС-6.03.648 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ РЕДУКТОРА ВИЛОК
РКС-6.03.649 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ РЕДУКТОРА ВИЛОК
РКС-6.22.634 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ РЕДУКТОРА ВИЛОК
РКС 6.03.652 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ РЕДУКТОРА ВИЛОК НОВОГО ОБРАЗЦА
РКС 6.03.693 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ РЕДУКТОРА ВИЛОК СТАРОГО ОБРАЗЦА
РКС-6.03.696 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ СОЕДИНИТЕЛЬНЫЙ (ГАНТЕЛЯ)
РКС 6.03.696-02 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ СОЕДИНИТЕЛЬНЫЙ (ГАНТЕЛЯ)
РКС-6.03.657 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ШЕСТЕРНЯ (Z=19),(ЦЕНТРАЛЬНОГО РЕДУКТОРА)
РКС-6.03.681 Комбайны РКС-6, МКК-6-02, РКМ-6, СПС-4,2А ВАЛ ШЕСТЕРНЯ (Z=28),(РАСПРЕД. РЕДУКТОРА)

Возможные неисправности при работе ботвоуборочной машины и способы их устранения

Количество просмотров публикации Возможные неисправности при работе ботвоуборочной машины и способы их устранения - 365

Неисправности, признаки их появления Способы устранения
Неудовлетворительный срез голо­вок корней (высокий, низкий, ко­сой, с рваной поверхностью) В соответствии с разделом 5.3 "Ре­гулировка ботвоуборочных машин"
Неудовлетворительное наведение машины на рядки Увеличить давление. Смазать телескоп
Потери ботвы при погрузке в ря­дом идущий транспорт или непол­ное заполнение тележки Установить наклон верхнего бара­бана. Изменить положение тележ­ки относительно машины

5.5 Назначение корнеуборочной машины МКК-6 (МКК-6-02, МКК-6-04)

Шестирядная корнеуборочная машина МКК-6 предназначена для уборки корней сахар­ной свеклы, посеянной с ширинои̌ междурядий 45, 60 см (рисунки 32.4, 32.5). Машина производит выкопку корней, очи­стку их от земли и растительных остатков, погрузку в транс­портное средство и работает качественно при нормальных почвенно-климатических условиях, высокой культуре зем­леделия и урожайности корнеплодов до 200...600 ц/га.

Машины корнеуборочные МКК-6, МКК-6-02 и МКК-6-04(таблица32.3). Состоят из корнеуборочной части и установленного на её раму трактора МТЗ-80/80Л, с которого сняты ведущие колеса, мост управляемых колес, ме­ханизм задней навески и др.

Корнеуборочная часть состоит (рисунок 32.4) из несущей рамы 3, опирающейся на мосты ведущих 8 и управляемых 15 колес, шнекового 10, поперечного 6, продольного 9 и погрузочного 1 транспортеров, механизма рулевого управ­ления 17, трансмиссии 4, электрической 2 и гидравличес­кой 19 систем, автомата вождения 16, гасителя 5.

На машине МКК-6 применен дисковый копатель, со­стоящий из дисковых копачей 14, двух кулачковых 12, 13 и битерного валов, приемного транспортера 11.

Для снижения поврежденной части корней при перехо­де с продольного на поперечный транспортер на лонжеро­нах рамы, над поперечным транспортером устанавливает­ся обрезиненный гаситель 5, на расстоянии Л от задней стенки бункера, равном 180...340 мм.

При отгрузке машины гаситель устанавливается в край­нее заднее положение.

1 - погрузочный транспортер; 2 - электрооборудование; 3 — рама; 4 — трансмиссия;

5 -гаситель; 6 - поперечный транспортер; 7 - ограждение; 8 — мост ведущих колес;

9 - продольный транспортер; 10 - шнековый транспортер 11 - приемный транспортер копателя; 12 - второй кулачковый вал; 13 — первый кулачковый вал; 14 - копач дисковый;

15 - мост управля­емых колес; 16 - автомат вождения; 17 - механизм рулевого управления;

18 - трактор; 19 - гидросистема.

Рисунок 32.4 - Схема корнеуборочной машины МКК-6

1 - трактор МТЗ-80/80Л; 2 - система автоматического контроля и сигнализации;

3 - погрузочный транспортер; 4 - ограждение; 5 - трансмиссия; 6 - электрооборудование;

7 -гаситель; 8 - поперечный транспортер; 9 - задний мост; 10 - шнековый транспортер;

11- копатель; 12 - копирующее колесо; 13 - передний мост; 14 - автомат вождения по рядкам; 15 - механизм рулевого управления; 16 - механизм подъема; 17 - гидросистема.

Информация по гражданским делам | Информация по судебным делам | Судебный участок мирового судьи № 6 | Зеленоградский АО

02-0658/6/2021 ∼ М-2811/6/2021 Истец: Андреева Т.А.
Ответчик: Андреев А.С.
Назначена беседа на 13.09.2021 15:40 2 - О расторжении брака супругов - имеющих детей 13.09.2021 15:40 Беседа Багрова М.А.
02-0657/6/2021 ∼ М-3241/6/2021 Истец: ООО "Право онлайн"
Ответчик: Евстигнеева Е.В.
Назначена беседа на 16.09.2021 09:30 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 09:30 Беседа Ломовицкая Е.А.
02-0656/6/2021 ∼ М-3242/6/2021 Истец: ООО "Право онлайн"
Ответчик: Елисеева В.В.
Назначена беседа на 16.09.2021 09:35 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 09:35 Беседа Ломовицкая Е.А.
02-0655/6/2021 ∼ М-3243/6/2021 Истец: ООО "Право онлайн"
Ответчик: Шевляков М.Н.
Назначена беседа на 16.09.2021 09:40 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 09:40 Беседа Ломовицкая Е.А.
02-0654/6/2021 ∼ М-3244/6/2021 Истец: ООО "Право онлайн"
Ответчик: Мельникова О.В.
Назначена беседа на 16.09.2021 09:45 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 09:45 Беседа Ломовицкая Е.А.
02-0653/6/2021 ∼ М-3245/6/2021 Истец: ООО "Право онлайн"
Ответчик: Никитина Е.О.
Назначена беседа на 16.09.2021 09:50 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 09:50 Беседа Ломовицкая Е.А.
02-0652/6/2021 ∼ М-3246/6/2021 Истец: ООО МФК "Займер"
Ответчик: Ходакова Н.Г.
Назначена беседа на 16.09.2021 09:55 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 09:55 Беседа Ломовицкая Е.А.
02-0651/6/2021 ∼ М-3206/6/2021 Истец: ООО "ЦДУ Инвест"
Ответчик: Князев К.А.
Назначена беседа на 16.09.2021 10:25 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 10:25 Беседа Ломовицкая Е.А.
02-0650/6/2021 ∼ М-3205/6/2021 Истец: ООО МФК "Займер"
Ответчик: Ходакова Н.Г.
Назначена беседа на 16.09.2021 10:20 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 10:20 Беседа Ломовицкая Е.А.
02-0649/6/2021 ∼ М-3204/6/2021 Истец: ООО МФК "Займер"
Ответчик: Егоров А.Д.
Назначена беседа на 16.09.2021 10:15 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 10:15 Беседа Ломовицкая Е.А.
02-0648/6/2021 ∼ М-3203/6/2021 Истец: ООО МФК "Займер"
Ответчик: Павлов И.К.
Назначена беседа на 16.09.2021 10:10 203 - Иски о взыскании сумм по договору займа, кредитному договору 16.09.2021 10:10 Беседа Ломовицкая Е.А.
02-0647/6/2021 ∼ М-2976/6/2021 Истец: Шелухина М.А.
Ответчик: Шелухин С.В.
Назначена беседа на 20.09.2021 09:40 2 - О расторжении брака супругов - имеющих детей 20.09.2021 09:40 Беседа Багрова М.А.
02-0646/6/2021 ∼ М-3174/6/2021 Истец: ООО "Ситиус"
Ответчик: Богословская М.Б.
Назначена беседа на 13.09.2021 15:00 203 - Иски о взыскании сумм по договору займа, кредитному договору 13.09.2021 15:00 Беседа Ломовицкая Е.А.
02-0645/6/2021 ∼ М-3225/6/2021 Истец: АО "Мосэнергосбыт"
Ответчик: Зайцев Г.Е., Петроченко Л.Ф.
Завершено, 26.08.2021 114 - О взыскании платы за жилую площадь и коммунальные платежи, тепло и электроэнергию Ломовицкая Е.А.
02-0644/6/2021 ∼ М-3223/6/2021 Истец: ООО "Балтийская Служба Взыскания"
Ответчик: Матвеева И.С.
Завершено, 26.08.2021 203 - Иски о взыскании сумм по договору займа, кредитному договору Ломовицкая Е.А.

Подшипник 306 (6306)

Описание

Основное обозначение 306 Полное обозначение 306 (6306) d (mm) 30 D (mm) 72 B (H) 19 Вес 0.35 Применение подшипника: Автокраны КС-3562А Прочие узлы и механизмы. Автокраны СМК-10 Прочие узлы и механизмы. Автомобили легковые - ГАЗ 3301, 4301, 4509 коробка отбора мощности. Автомобиль БелАЗ -7420-9590 КПП Автомобиль БелАЗ -7519 КПП Автомобиль БелАЗ -75191 (110т) КПП Автомобиль БелАЗ -75211 КПП Автомобиль БелАЗ -75211 (180т) КПП Автомобиль БелАЗ -7548 Система питания/опережение впрыска Автомобиль БелАЗ -7548 (40т) Двигатель-система питания/Муфта опережения впрыска Автомобили "Газель" ГАЗ-27057, 32217, 322172, 322173, 3301, 33027, 330273 КПП. Автомобиль ГАЗ-66, 66 с лебедкой КПП, 66-02, 66-05, 66-11, 66-12 КПП. Автомобиль грузовой - БелАЗ 7548 двигатель: система питания. Автомобиль грузовой - БелАЗ 7548 муфта опережения впрыска. Автомобиль грузовой - ГАЗ 3301, 66-11 коробка отбора мощности. Автомобиль грузовой - МАЗ 543, 547, 7310, 7410, 73101 генератор. Автомобиль грузовой - САЗ 4509 коробка отбора мощности. Автомобиль грузовой - УАЗ все модели пром. вал задн.. Автомобиль ЗАЗ Таврия КПП. Автомобиль ЗИУ-9 В (682 В) Генератор/Электрооборудование. Автомобиль ИЖ-21251, 2715-01, 27151-01, 27156, 412, 412ИЭ, 427, 434. Автомобиль КамАЗ-5320, 53211, 53212, 53213, 5410, 54112, 55102, 55111. Автомобиль КЗКТ-Э 538 ДК Двигатель/Коробка дополнительная. Автомобиль МАЗ-537, 537Г, 538 Двигатель. Автомобиль МАЗ-543, 547, 7310, 73101, 7410 Генератор Г-24/Двигатель. Автомобиль Москвич М-2137, 2140, 2141, 2737, 412 АЗЛК КПП:вал первичный.. Автомобиль УАЗ-2206, 31512, 31512 с бортовой передачей, 31514, 31514 с бортовой передачей, 3153, 3303, 33036, 3741, 3909, 3962. Автомобильные краны Автомобильный транспорт АКР КС-3562А, 3577, 3579 вал промежуточный КП, ось промежуточной шестерни К. АКР СМК-10 вал промежуточный КП, ось промежуточной шестерни К. Двигатели для автомобильного транспорта и с/х техники Д-65М, 65М1, 65Н1 Прочие узлы и механизмы. Тяговое оборудование электрические машины и механизмы электронасосы ЭЦТ-63/10. Мотоблок МТЗ МТЗ-05 (и его модификации) КПП. Основное и вспомогательное оборудование горно-обогатительных комбинатов. Основное и вспомогательное оборудование металлургического производства. Перерабатывающее оборудование. Подшипники для бронетанковой техники. Сельскохозяйственные машины. Комбайны зерноуборочные Е-1200, 1200-1, 1200Р Прочие узлы и механизмы Комбайны зерноуборочные - СК 6 вал промежуточный КП, ось промежуточной шестерни К. Комбайны зерноуборочные - СК-5А, 5М, 6-11, 6А Прочие узлы и механизмы. Комбайны зерноуборочные - СКП-5А, 5М Прочие узлы и механизмы. Комбайны кормоуборочные - КСГ-3, 2А Прочие узлы и механизмы. Комбайны корнеуборочные - МКК 6, 6-02, 6-04 редуктор. Комбайны корнеуборочные - РКМ 39088, 39147 редуктор. Комбайны рисоуборочные - СКГД-6 Прочие узлы и механизмы. Перерабатывающее оборудование 4ПП2, А1ВВС, А1-ОХО, А1-ОЦР-5, АММ6-1-12, АРУ-М, ВРУ, ВСБ-М, Е6-АССМ, Ж7-ШМК, К6-АТИМ-2, М8-АКС, ОМД-6, ОМЖ, ОР6У, РТ-ОМ-4, 6М, Урал-10КС Прочие узлы и механизмы. Станкостроение радиально-сверл.2К52-2 вал. Станкостроение токарно-винторезный ИТ-1М вал. Станкостроение токарно-револьверный 1В116 вал. Станкостроение токарно-револьверный 1В116П вал. Дорожные машины - ДУ 72 навесное на ЗИЛ-130. Экскаваторы - МТП-71 Прочие узлы и механизмы. Экскаваторы - ТЭ 3М вал промежуточный КП, ось промежуточной шестерни К. Экскаваторы - ТЭ-3М Прочие узлы и механизмы. Экскаваторы - ЭТР 162 вал промежуточный КП, ось промежуточной шестерни К. Экскаваторы - ЭТЦ 165 вал промежуточный КП, ось промежуточной шестерни К. Экскаваторы - ЭТЦ-165 Прочие узлы и механизмы. Тепловоз ТЭ-3 дизель 2Д100 привод масляного насоса. Трактор ДТ-20, 65М Прочие узлы и механизмы. Трактор ДЭТ 250 колесный редуктор - главная передача, Прочие узлы и механизмы. Трактор МТЗ 50, 52 вал опоры промежуточной корданного вала, задняя. Трактор МТЗ 82, 82Л, 82Н колесный редуктор - главная передача. Трактор МТЗ МТЗ-220 (мини-трактор) Мост задний. Трактор МТЗ-5, 5К, 52, 52Л, 80, 80Л, 800, 82, 82Л, 82Р, 820 ,900, 920 редуктор колесный. Трактор Т 12, 25, 25А колесный редуктор - главная передача. Трактор Т 16МГ комплектация. Трактор Т 130 водяной насос и его привод Трактор Т 150К, 150К-27, 25, 16 самоходное шасси прочие узлы и механизмы. Трактор ХТЗ 120 колесный редуктор - главная передача. Трамваи КТМ-5МЗ генератор Г-731А. Трамваи КТМ-5МЗ двигатель ДК-661. Троллейбусы - ЗИУ 52642 двигатель ДК-661Б. Тяговое оборудование электрические машины и механизмы синхронный возбудитель ВС-652. Тяговое оборудование Электрические машины и механизмы. Экскаватор КЗКТ-Э 538 ДП Двигатель/Коробка дополнительная. Экскаватор ЭКГ-4 У, 8п Электрооборудование. Станкостроение 1ИС611В Станок токарно-винторезный высокой точности универсальный схемы Редуктор.

Лабораторна робота №29 коренезбиральні машини

1. Мета роботи: вивчити будову, процес роботи та регулювання коренезбиральної машини КС-6Б. Ознайомитись з особливостями конструкції самохідної коренезбиральної машини РКС-6 (МКК-6). Ознайомитись з підготовкою машин до роботи.

2. Тривалість заняття – 2 академічні години.

3. Обладнання робочого місця: коренезбиральна машина КС-6, плакати, стенд з робочими органами.

4. Місце проведення заняття: лабораторія №2 грунтообробних, посівних та збиральних машин кафедри с.-г. машин.

5. Загальні відомості

Для збирання коренеплодів цукрових і кормових буряків використовують чотири- і шестирядні самохідні коренезбиральні машини і бункерні комбайни, а також причіпні та навісні копачі-валкоутворювачі і підбирачі валків. Базовими вітчизняними моделями цих машин є самохідні машини КС-6Б(В), МКК-6, РКМ-6, а також комплекс причіпних машин КВЦБ-1,2 (копач-валкоутворювач) і КНБ-6 (підбирач валків) концерну «Борекс».

Коренезбиральна машина МКК-6-02 (рис. 29.1) призначена для збирання коренеплодів цукрових буряків, що посіяні з шириною міжрядь 45 см і складається з основної рами 1, на якій змонтовано коренезбиральну частину та встановлено трактор 13 МТЗ-80/80Л із демонтованими ведучими колесами, мостом керованих коліс, механізмом задньої начіпки. Робочі органи коренезбиральної частини приводяться в рух від ВВП трактора.

Коренезбиральна частина має основну раму 1, яка опирається на мости ведучих 12 і керованих 3 коліс, дві секції вилчастих викопувальних пристроїв 4, приймальний лопатевий конвеєр-очисник 9, шнековий очисник вороху 10, поздовжній 11 і поперечний 16 конвеєри, вивантажувальний елеватор 14, механізм рульового керування, трансмісію, електричну і гідравлічну системи, автомат керування машини по осі рядків, систему контролю та сигналізації УСАК-6В.

Викопувальний пристрій, або копач (див. рис. 29.2), призначений для викопування коренеплодів цукрових буряків, попереднього очищення вороху від домішок і його транспортування на шнековий очисник. Копач має ліву і праву секції, кожна з яких складається із рами 2, на якій змонтовано три пари активних вилок 6, три пари коренезабірників 1, металевий бітер-виштовхувач 3 і приймальний лопатевий конвеєр-очисник, виконаний у вигляді послідовно розміщених прогумованих бітерних валів.

Секції копача шарнірно з’єднані з основною рамою машини і в роботі опираються на кронштейни рамки копіювальних коліс, завдяки чому відбувається незалежне копіювання рельєфу ґрунту кожною рамкою.

Рис. 29.1. Загальний вигляд (а) та конструктивно-технологічна схема (б, в) коренезбиральної машини МКК-6-02:

1 – основна рама; 2 – автомат водіння; 3 – кероване колесо; 4 – секція викопувальних робочих пристроїв; 5 – копіювальне колесо; 6 – коренезабірник; 7 – активна викопувальна вилка; 8 – бітер-виштовхувач; 9 – лопатевий конвеєр-очисник; 10 – шнековий очисник; 11 – поздовжній конвеєр; 12 – ведуче колесо; 13 – трактор; 14 – вивантажувальний елеватор; 15 – бункер-нагромаджувач; 16 – поперечний конвеєр.

б

в

а

Рис. 29.2. Викопувальний пристрій коренезбиральної машини МКК-6-02:

а – викопувальний пристрій у складі; б – активна вилка; 1 – коренезабірник; 2 – рама; 3 – бітер-виштовхувач; 4 – вал приводу бітера-виштовхувача; 5 – редуктор приводу вилок; 6 – активна вилка; 7 – конусні ротори; 8 – манжета; 9 – труба; 10 – шарикопідшипник; 11 – корпус; 12 –конічна шестірня редуктора; 13 – вал; 14 – кронштейн.

Активна вилка (див. рис. 29.2, б) призначена для викопування коренеплодів із ґрунту. Вона складається з двох конусів 7, які обертаються в протилежні боки і змонтовані на хвостовиках валів 13 і шестерень 12. Конусні вилки встановлені на кронштейні 14, який закріплений на рамі викопувального пристрою. Діаметр циліндра вилки 72 мм, довжина активної частини 332 мм. Частота обертання конусів 7 становить 423 об/хв, глибина ходу вилок – 5...12 см.

Коренезабірник 1 призначений для захоплювання коренів і передачі їх на приймальний лопатевий конвеєр-очисник. Він складається із зварного корпусу, верхнього ведучого вала, ведучої і веденої зірочок, маточини з поздовжнім пазом, маточин і півосей із сухарями. На півосях закріплені диски, які розміщені під кутом один до одного. Верхній ведучий вал коренезабірника приводиться в рух від вала контрприводу через з’єднувальний валик. Ланцюгова передача коренезабірника передає обертання з верхнього вала на нижню зірочку і далі через сухарі і півосі на диски з прутковими лапами. Діаметр дисків 700 мм, частота обертання 99 об/хв.

Приймальний лопатевий конвеєр-очисник призначений для очищення вороху від землі та рослинних домішок і подальшого подавання його на шнековий конвеєр. Він складається з трьох бітерних валів, які виконані у вигляді радіально розміщених гумових лопатей. Перші два вали мають по чотири лопаті, а третій – шість. Частота обертання двох чотирилопатевих бітерів становить 188 об/хв, а шестилопатевого – 289 об/хв.

Ш

Рис. 29.3. Шнековий очисник:

1 – довгий валець; 2 - спіральне навивання; 3 і 4 – короткі вальці.

нековий очисник (рис. 29.3) машини МКК-6-02 призна-чений для часткового подальшого очищення вороху цукрових буряків від землі та рослинних домішок і зміщення й подавання його з приймальних конвеєрів двох секцій викопуваль-ного робочого органу на центральний поздовжній конвеєр. Він складається з правої та лівої секцій, кожна з яких має вигляд двох довгих 1 і двох коротких 3, 4 вальців, які закріплені в сферичних підшипникових опорах на основній рамі машини. На деякій визначеній довжині нижні вальці кожної секції мають спіральне навивання 2 із стрічки, а короткий валець 3 – із круга для зміщення вороху на поздовжній конвеєр. Валець 3 на кінці має зворотний виток, який обрізує рослинні залишки, що захоплюються шнековим конвеєром. Верхній валець 4 виконаний гладеньким. Вальці мають однаковий напрямок обертання. Частота обертання спіральних вальців становить 289 об/хв, гладенького – 377 об/хв.

Поздовжній і поперечний конвеєри призначені відповідно для забирання вороху від шнекового очисника і подавання його на поперечний конвеєр та від нього до вивантажувального.

Поздовжній конвеєр закріплений на основній рамі машини і складається з ведучого вала із запобіжною муфтою, полотна, ведених і підтримувальних роликів. На полотні конвеєра влаштовані скребки і клапан для очищення внутрішнього простору полотна. Полотно натягується автоматично за допомогою натяжних пристроїв.

Поперечний конвеєр є дном бункера-нагромаджувача. Він складається із полотна, ведених і підтримувальних роликів і ведучого вала, клапана очищення внутрішнього простору. Полотно конвеєрів має два втулково-роликових ланцюги, з’єднані між собою прутками з кроком 38,1 мм. На прутках з кроком 304,8 мм закріплені скребки 50 мм заввишки. Швидкість руху полотна конвеєра 1,22 м/с.

Вивантажувальний елеватор призначений для завантаження коренеплодів у кузов транспортного засобу, який рухається поряд із коренезбиральною машиною. На рамі конвеєра встановлені гребінка і козирок-зменшувач швидкості падіння коренеплодів, який запобігає їх пошкодженню і втратам. Ведучий вал, полотно із скребками, ведені і підтримувальні ролики виконані аналогічно поздовжньому конвеєру. Крок скребків 457,2 мм, висота – 142 мм.

Для заміни транспортних засобів без зупинення машини під час роботи передбачена можливість короткострокового вимкнення поперечного конвеєра і вивантажувального елеватора. У цей час коренеплоди нагромаджуються в перехідному бункері-нагромаджувачі 15, дном якого є поперечний конвеєр 16. Після заміни транспортних засобів вмикають привід конвеєрів і коренеплоди знову надходять у новий транспортний засіб.

Технологічні регулювання. Глибину ходу активних вилок регулюють за допомогою перестановки штирів і втулок у кронштейнах копіювальних коліс викопувального пристрою.

Копіри автомата водіння машини по рядках буряків регулюють залежно від розміру коренів. Відстань між пластинами суміжних копірів має бути на 2...3 см більшою за середній діаметр коренів і встановлюється зміщенням копіювальних пластин у горизонтальній площині. Паралельне положення пластин копірів відносно поверхні ґрунту для копірів-розпушувачів досягається поворотом у вертикальній площині пластин копірів у затискачах, для полозкових копірів – зміною довжини тяги паралелограмної підвіски копірів.

Коренезбиральна самохідна машина РКМ-6 призначена для викопування коренеплодів цукрових буряків, посіяних з міжряддями 45 см.

Машина РКМ-6 (рис. 29.4) складається із самохідного шасі, на рамі якого встановлено двигун 13 СМД-24-02 потужністю 118 кВт, міст ведучих коліс 9 з гідростатичним приводом ходової частини, міст керованих коліс 2, кабіну з органами керування 14, автомат керування машини по рядках 1 і коренезбиральну частину.

Основними робочими органами коренезбиральної частини є двосекційні викопувальні органи 5, встановлені у передній частині двох рухомих рам і шарнірно з’єднані з основною рамою, ліві і праві секції приймального лопатевого бітерного 6 і шнекового 7 очисників, які виконані у вигляді послідовно розміщених лопатевих і спіральних вальців, поздовжнього пруткового конвеєра 8, лопатевого бітерного доочисника вороху коренеплодів 10, поперечного конвеєра 11 і вивантажувального елеватора 12.

Залежно від комплектації змінного викопувального робочого органа розрізняють такі модифікації коренезбиральної машини: РКМ-6-02 комплектується ротаційно-вилчастими копачами, РКМ-6-03 – пасивними сферичнодисковими копачами (для збирання кормових буряків), РКМ-6-05 – дисковими копачами, будова і технологічний процес роботи яких відповідно аналогічні машинам МКК-6-02, МКК-6, КС-6Б(В).

Приймальний бітерний лопатевий очисник 6, шнековий очисник 7, поздовжній 8 і поперечний 11 конвеєри та вивантажувальний елеватор 12, бітерний лопатевий доочисник 10 за своєю будовою і технологічним процесом роботи аналогічні відповідним робочим органам коренезбиральної машини МКК-6-02.

Коренезбиральна машина КС-6Б призначена для збирання коренеплодів цукрових буряків, що посіяні з шириною міжрядь 45 см. Вона комплектується самохідним шасі та коренезбиральною частиною. У передній частині самохідного шасі влаштований автомат водіння для спрямування робочих органів по осі рядків коренеплодів.

а

б

Рис. 29.4. Загальний вигляд (а) та конструктивно-технологічна схема (б) коренезбиральної машини РКМ-6:

1 – автомат керування; 2 – міст керованих коліс; 3 – копіювальне колесо; 4 – коренезабірник; 5 – активна викопувальна вилка; 6 – бітерний лопатевий очисник; 7 – шнековий очисник; 8 – поздовжній конвеєр; 9 – міст ведучих коліс; 10 – бітерний лопатевий доочисник; 11 – поперечний конвеєр; 12 – вивантажувальний елеватор; 13 – двигун; 14 – кабіна.

Коренезбиральна частина машини КС-6Б (рис. 29.5) складається із шести пар дискових копачів 3, лопатевого бітера-виштовхувача 4, шнекового очисного пристрою, виконаного у вигляді послідовно розташованих двох пар спіральних вальців 5 і розміщеного між ними та за другою парою вальців 5

а

б

Рис. 29.5. Загальний вигляд (а) та конструктивно-технологічна схема (б)

MKK6 функционирует в двух параллельных каскадах MAP-киназ в иммунной передаче сигналов

Рисунок 3.

MEKK1, MKK6 и MPK4 работают в каскаде MAPK. A, Морфология 3-недельного ребенка…

Рисунок 3.

MEKK1, MKK6 и MPK4 работают в каскаде MAPK. А. Морфология 3-недельных растений дикого типа (WT), summ4-1D , mekk1-1 и summ4-1D mekk1-1 .B и C, уровни экспрессии PR1 (B) и PR2 (C) в диком типе, mekk1-1 и summ4-1D mekk1-1 . Значения были нормализованы относительно экспрессии ACTIN1 . Планки погрешностей представляют собой стандартные отклонения от трех измерений. D, Морфология 3-недельных растений дикого типа, summ4-1D , mpk4-3 и summ4-1D mpk4-3 . E и F, уровни экспрессии PR1 (E) и PR2 (F) у дикого типа, mekk1-1 и summ4-1D mekk1-1 .Значения были нормализованы относительно экспрессии ACTIN1 . Планки погрешностей представляют собой стандартные отклонения от трех измерений. G, Взаимодействие между MKK6 и MEKK1 или MPK4. Активности люциферазы из анализов комплементации расщепленной люциферазы, представленные в относительных световых единицах (RLU). Планки погрешностей представляют собой стандартные отклонения от восьми повторов. Статистические различия между образцами обозначены разными буквами ( P <0,05, односторонний дисперсионный анализ ANOVA / критерий Тьюки, n = 8).H, Анализ взаимодействия между MKK6-3HA и MEKK1-3FLAG путем коиммунопреципитации. Белки временно экспрессировались в N. benthamiana с использованием штаммов Agrobacteria , несущих 35S-MKK6-3HA или нативный промотор, управляемый MEKK1-3FLAG (np-MEKK1-3FLAG). Иммунопреципитацию проводили с использованием гранул анти-FLAG. Вестерн-блоттинг проводили с использованием антител против FLAG или против НА. I, активация MAPK у дикого типа (WT), summ2-8 mkk1 / 2 и summ4-1D mkk1 / 2 .Растения опрыскивали flg22 при длине волны 100 нм. Образцы собирали через 0 и 15 мин после обработки flg22. Активацию MAPK детектировали иммуноблоттингом с антителом против p44 / 42 ERK. Вход был визуализирован окрашиванием Рубиско по Понсо. J. Конструкцию 35S-MPK4-HA-YCE котрансфицировали с 35S-MKK6-3HA в протопласты, выделенные из дикого типа, summ2-8 mkk1 / 2 и summ2-8 mekk1-1 . Образцы обрабатывали 100 нм flg22 или без него в течение 15 минут перед их сбором для вестерн-блоттинга с использованием антител против p44 / 42 ERK или против HA.

Антитело MKK6

Ограниченное использование

Если иное прямо не согласовано в письменной форме, подписанной законным представителем CST, следующие условия: применяются к Продуктам, предоставляемым CST, ее аффилированными лицами или ее дистрибьюторами. Любые условия и положения Заказчика, указанные в дополняют или отличаются от содержащихся в настоящем документе, если иное не принято в письменной форме юридически уполномоченным представитель CST, отклоняются и не имеют силы.

Продукты имеют маркировку «Только для исследовательского использования» или аналогичное заявление о маркировке и не были одобрены, одобрены или лицензированы. FDA или другой регулирующей иностранной или отечественной организацией для любых целей. Заказчик не должен использовать какой-либо Продукт для диагностики. или в терапевтических целях, или иным образом любым способом, который противоречит заявлению на этикетке. Продукты, продаваемые или лицензируемые CST предоставляются Заказчику как конечному пользователю и исключительно для целей исследований и разработок.Любое использование Продукта для диагностики, в профилактических или терапевтических целях, или любая покупка Продукта для перепродажи (отдельно или в качестве компонента) или в других коммерческих целях, требуется отдельная лицензия от CST. Клиент обязуется (а) не продавать, лицензировать, ссужать, жертвовать или иным образом передавать или предоставлять любой Продукт для любой третьей стороны, отдельно или в сочетании с другими материалами, или использовать Продукты для производства любых коммерческие продукты, (б) не копировать, изменять, реконструировать, декомпилировать, дизассемблировать или иным образом пытаться обнаружить лежащие в основе структуру или технологию Продуктов, или использовать Продукты с целью разработки любых продуктов или услуг, которые конкурировать с продуктами или услугами CST, (c) не изменять и не удалять из Продуктов какие-либо товарные знаки, торговые наименования, логотипы, патенты или уведомления об авторских правах или маркировка, (d) использовать Продукты исключительно в соответствии с Условия продажи продуктов CST и любые применимые документации, и (e) соблюдать любую лицензию, условия обслуживания или аналогичное соглашение в отношении любых сторонних продуктов или услуги, используемые Клиентом в связи с Продуктами.

MKK6 контролирует T3-опосредованное потемнение белой жировой ткани

Исследуемая популяция и сбор образцов

Исследуемая популяция включала 58 взрослых с индексом массы тела (ИМТ) ≥35, перенесших плановую бариатрическую операцию в университетской больнице Саламанки. Пациенты были исключены, если у них в анамнезе было злоупотребление алкоголем или чрезмерное употребление алкоголя (> 30 г в день у мужчин и> 20 г в день у женщин), хронический гепатит C или B. Были набраны контрольные субъекты ( n = 13). среди пациентов, перенесших лапароскопическую холецистэктомию по поводу желчнокаменной болезни.Исследование было одобрено этическим комитетом университетской больницы Саламанки, и все субъекты предоставили письменное информированное согласие на проведение биопсии висцерального жира под контролем зрения во время операции.

Были собраны данные по демографической информации (возраст, пол и этническая принадлежность), антропоморфным измерениям (ИМТ), курению и алкоголю, сопутствующим заболеваниям и использованию лекарств. Перед операцией брали образцы венозной крови натощак для измерения общего количества клеток крови, общего билирубина, аспартатаминотрансферазы (АСТ), АСТ аланина (АЛТ), общего холестерина, липопротеинов высокой плотности, липопротеинов низкой плотности, триглицеридов, креатинина, глюкозы и т. Д. и альбумин (дополнительная таблица 1).

Животные модели

Использование и получение мышей WT C57Bl6J и мышей с нокаутом, лишенных киназы MKK6, при гомозиготности ( Mkk6 - / - , B6.129- Карта 2 k 6 tm1Flv ) была описана ранее 43 . Все животные содержались на фоне C57BL / 6J (10 поколений обратного скрещивания). Мышей с мутацией зародышевой линии в гене Map2k6 и элементами LoxP, вставленными в два интрона (Map2k6LoxP), получали после гомологичной рекомбинации в ES-клетках.ES-клетки подвергали электропорации с этим вектором (дополнительный рис. 4g) и отбирали с помощью 200 мкг / мл G418 и 2 мкМ ганцикловира. Несколько правильно нацеленных клонов ES-клеток идентифицировали саузерн-блоттингом и ПЦР. Эти клоны ES-клеток инъецировали в бластоцисты C57BL / 6J для создания химерных мышей, которые передавали мутированный аллель Map2k6 через зародышевую линию. Кассету Flp NeoR вырезали путем скрещивания этих мышей с мышами ACTB: FLPe B6; SJL, которые экспрессируют ген рекомбиназы FLP1 под управлением промотора ACTB человека.Этих животных скрещивали с линией FVB-Tg (Ckmm-cre) 5Khn / J на ​​фоне C57BL / 6J (лаборатория Джексона) для получения мышей, лишенных MKK6 в мышцах, и с B6.Cg-Tg (Alb-cre) 21Mgn / J для делеция в гепатоцитах. Генотип подтвержден ПЦР-анализом геномной ДНК. Самцов мышей кормили нормальной пищей или HFD (Research Diets Inc.) в течение 8 недель без ограничений. Обработку PTU вводили в течение 8 недель в питьевой воде в концентрации 1,2 мМ вместе с Kool Aid для улучшения вкуса. В некоторых экспериментах Т3 (3 мкг / 100 г в 0.2% BSA – PBS) вводили внутрибрюшинно. ежедневно. Для температурных экспериментов мышей содержали при 30 ° C в течение 8 недель во время кормления HFD в случае термонейтрального анализа и подвергали воздействию 4 ° C в течение 1 часа или 1 недели после обработки HFD в случае исследований адаптации к холоду. Все процедуры с животными соответствовали Директиве ЕС 86/609 / EEC и Рекомендации 2007/526 / EC относительно защиты животных, используемых в экспериментальных и других научных целях, принятой в соответствии с испанским законом 1201/2005. Процедуры были рассмотрены Комитетом по институциональному уходу и использованию животных (IACUC) Национального центра исследований кардиоваскулярных заболеваний и одобрены Consejeria de Medio Ambiente, Administración Local y Ordenación del Territorio муниципального образования Мадрид.

Производство лентивирусных векторов и инфицирование мышей

Лентивирусы получали, как описано 44 . Вкратце, временную котрансфекцию фосфатом кальция клеток HEK-293 проводили с пустым pGIZP, pGIZP.sh Mkk6 , pGIZP.sh Ampk , pGIZP.sh Tak1 , pGIZP.sh Tab1 или pGIZT.sh Mapk14 векторов от Thermo Scientific вместе с pΔ8.9 и pVSV-G. Супернатанты, содержащие частицы LV, собирали через 48 и 72 ч после удаления осадка фосфата кальция, центрифугировали при 700 × g, 4 ° C в течение 10 минут и концентрировали (165 ×) ультрацентрифугированием в течение 2 часов при 121986 g при 4 ° C (Ultraclear Tubes, ротор SW28 и ультрацентрифуга Optima L-100 XP; Beckman).Вирусы собирали добавлением холодного стерильного PBS и титровали количественной ПЦР.

Мышам вводили в VMH или хвостовую вену лентивирусные частицы, суспендированные в PBS. Через семь дней после заражения мышей кормили диетой HFD.

Культура клеток

Для получения белых преадипоцитов, WT и Mkk 6 - / - паховый жир механически и ферментативно дезагрегировали с использованием коллагеназы типа A (2 мг / мл коллагеназы типа A, Roche) при 37 ° С.Суспензию клеток пропускали через сетчатый фильтр для клеток 70 мкм (Falcon) для удаления стромы и дебриса и центрифугировали при 400 × g в течение 8 мин при комнатной температуре. Осадок собирали и клетки подсчитывали, используя счетчик клеток CasyTon. Преадипоциты были мортализованы путем инфицирования вирусом SV40T-pBABE-neo. Клетки дифференцировали до адипоцитов в течение 9 дней в среде 8% FCS с добавлением 5 мкг / мл инсулина, 25 мкг / мл IBMX, 1 мкг / мл дексаметазона и 1 мкМ троглитазона. Затем культуры инкубировали со 100 нМ Т3, 100 нМ Т4 и 1 мкМ норэпинефрином в течение 48 ч перед экстракцией.В качестве альтернативы преадипоциты были дифференцированы в адипоциты с использованием протокола дифференцировки коричневых адипоцитов, в котором клетки индуцировали до коричневого жира с помощью 20 нМ инсулина, 1 нМ Т3, 125 мкМ индометацина, 2 мкг / мл дексаметазона и 50 мМ IBMX в течение 48 часов, и поддерживается 20 нМ инсулина и 1 нМ Т3 в течение 8 дней. В некоторых экспериментах белые преадипоциты инфицировали лентивирусом, содержащим кшРНК, нацеленную на AMPK, TAK1, TAB1, p38α или скремблированную последовательность, и отбирали по устойчивости к пуромицину.

Клеточные культуры, использованные в этой статье, были протестированы на микоплазменную инфекцию.

Анализ функции митохондрий

Пре-дипоциты высевали и дифференцировали в покрытых желатином (0,1%) 96 пластинах с морскими коньками. Стимуляцию Т3 проводили за 48 ч до анализа потребления кислорода. Скорость потребления кислорода (OCR) MitoStress оценивали в среде XF, содержащей либо 25 мМ глюкозы (среда окисления глюкозы), либо 1 мМ пальмитата, 2 мМ l-глутамина и 1 мМ пирувата натрия (среда окисления жирных кислот) с использованием внеклеточного XF-96. анализаторы потока (Seahorse Bioscience, Agilent Technologies) и данные, нормализованные по количеству клеток (CyQuant, Invitrogen).Была рассчитана запасная дыхательная способность (OCR карбонилцианид-4- (трифторметокси) фенилгидразон (FCCP) / OCR базальная) и потребление кислорода в ответ на норэпинефрин (NE) (кратное увеличение (FI) NE / базальное).

Вестерн-блот

Образцы лизировали буфером RIPA, содержащим ингибиторы протеаз и фосфатаз (Tris-Hcl 50 мМ, pH 7,5; Triton X-100 1%; EDTA 1 мМ, pH 8; EGTA 1 мМ; NaF 50 мМ. ; β-глицерофосфат-Na 1 мМ; пирофосфат натрия 5 мМ; ортованадат-Na 1 мМ; сахароза 0.27 М; ФМСФ 0,1 мМ, β-меркаптоэтанол 1 мМ, апротинин 10 мкг / мл и лейпектин 5 мкг / мл). Лизаты разделяли с помощью SDS-PAGE и инкубировали в разведении 1/1000 с антителами против фосфо-Akt (Thr308) антител (Cell Signaling Technology, кат. № 9275s), фосфо-Akt (Ser473) антителами (Cell Signaling Technology, кат. № 9271s), Антитело Akt (Cell Signaling Technology, кат. № 9272s), фосфо-ATF2 (Thr69 / 71), антитело (Cell Signaling Technology, кат. № 9225s), антитело ATF2 (20F1) (Cell Signaling Technology, кат. № 9226s), фосфо-CREB (Ser133) ( 87G3) (Cell Signaling Technology cat # 9198), фосфо-p38 (Thr180 / Tyr182) антитела (Cell Signaling Technology cat # 9211s), фосфо-AMPKalpha (Thr172) антитела (Cell Signaling Technology cat # 2531s), AMPKalpha (23A3) антитело (Cell Signaling Technology, кат. № 2603s), антитело к фосфоацетил-CoA-карбоксилазе (Ser79) (Cell Signaling Technology, кат. № 3661s), антитело к ацетил-CoA-карбоксилазе (C83B10) (Cell Signaling Technology, кат. № 3676s), TAK1 (D94D7) антитело (Cell Signaling Technology, кат. № 5206s), антитело TAB1 (C-20) (Santa Cruz Biotech nology cat # sc-6053), антитело p38alpha (C-20) (Santa Cruz Biotechnology cat # sc-535), моноклональное анти-винкулин (клон hVIN-1) антитело (Sigma-Aldrich cat # V9131), поликлональное антитело MKK6 ( Stressgen Biotechnologies, каталожный номер ADI-KAP-MA014-E) или антитело против UCP1 (Abcam, каталожный номер AB10983), все использовали в соотношении 1: 1000, с последующей инкубацией со вторичным антителом, конъюгированным с пероксидазой хрена (HRP) (1: 5000). ).Реактивные полосы детектировали с помощью хемиолюминесценции и количественно оценивали с помощью программного обеспечения Image J. Необрезанные изображения вестерн-блоттинга показаны на дополнительном рисунке 10.

Гистологическое окрашивание

Свежую печень, белый жир и бурый жир фиксировали 10% формалином, добавляли в парафин и разрезали на 5-миллиметровые слайды с последующим гематоксилином и гематоксилином. окрашивание эозином. Размер адипоцитов определяли количественно с использованием программного обеспечения Image J.

Капли жира были обнаружены путем окрашивания масляным красным (0,7% в пропиленгликоле) на 8-миллиметровых предметных стеклах, включенных в состав ОКТ (Tissue-Tek © ).

Тест на толерантность к глюкозе

Мышам, голодным в течение ночи, вводили внутрибрюшинную инъекцию. с 1 г / кг глюкозы и уровнями глюкозы в крови, определенными глюкометром Ascensia Breeze 2 через 0, 15, 30, 60, 90 и 120 минут после инъекции.

Тест на толерантность к инсулину

Тест на толерантность к инсулину был проведен внутрибрюшинно. 0,75 МЕ / кг инсулина у мышей, голодавших в течение 1 часа и определяющих уровни глюкозы в крови глюкометром в различные моменты времени после инъекции (0, 15, 30, 60, 90 и 120), как показано на рисунке.

Высвобождение и измерение инсулина

Мышам вводили 2 г / кг глюкозы, а кровь собирали субмаксилярной пункцией через 0, 10 и 30 мин после инъекции. Количество инсулина определяли в сыворотке с помощью мультиплексного ELISA с анализатором Luminex 200 (Bio-Rad) в соответствии с инструкциями производителя.

Система непрямой калориметрии

ЭЭ, респираторный обмен, двигательная активность и потребление пищи определялись количественно с помощью системы непрямой калориметрии (TSE LabMaster, TSE Systems, Германия) в течение 2 дней.

Температура

Температуру тела определяли ректальным термометром (портативный цифровой одинарный термометр AZ 8851K / J / T, AZ Instruments Corp., Тайвань).

Межлопаточная температура, прилегающая к НДТ, была определена количественно с помощью термографических изображений с использованием инфракрасной камеры FLIR ® T430sc (FLIR Systems, Inc., Уилсонвилл, Орегон) и проанализирована с помощью программного обеспечения FlirIR.

Магнитно-резонансная томография и анализ ЯМР-спектроскопии.

Массу жира анализировали с помощью магнитно-резонансной томографии (анализатор состава всего тела; EchoMRI, Хьюстон, Техас, США).

Спектроскопические исследования WAT были выполнены in vivo на доклинической системе 7T (Agilent Varian, Пало-Альто, США), оснащенной консолью DD2 и активной экранированной спиралью с градиентом 205/120 с максимальной силой 130 мТл / м. Для фосфор / протонов (20 мм) использовали двойную настроенную круговую передающую / приемную катушку, помещенную поверх придаточного жира и BAT (Rapid Biomedical GmBH, Rimpar Germany).

Спектры ЯМР протонов были получены с помощью 128 переходных процессов с 2048 комплексными точками со спектральной полосой пропускания 10 кГц и временем повторения 1.2 мс. Спектры были получены с помощью адиабатических радиочастотных импульсов для повышения чувствительности и минимизации спектральных искажений с помощью угла поворота Эрнста. Химические сдвиги были выражены относительно сигнала воды (4,7-4,8 ppm) в 1 H-MRS и фосфокреатина (0 ppm) в 31 P-MRS. Сигналы в спектрах ЯМР определялись количественно путем интегрирования после автоматической или ручной коррекции базовой линии с подгонкой каждого пика спектра (после коррекции фазы и базовой линии) к функции Лоренца с использованием программы Mestrenova (Mestrelab Research, Сантьяго-де-Компостея, Испания; выпущено) 2015-02-04 версия: 10.0.1-14719) на компьютере Macintosh. Перед преобразованием Фурье применялось экспоненциальное уширение линии (3 Гц для протона).

qRT-PCR

РНК 1 мг, экстрагированная с помощью набора RNeasy Plus Mini (Quiagen © ) в соответствии с инструкциями производителя, была транскрибирована в комплементарную ДНК и qRT-PCR, выполненная с использованием зонда Fast Sybr Green (Applied Biosystems) и соответствующих праймеров в термоциклере 7900 Fast Real Time (Applied Biosystems). Относительную экспрессию мРНК нормализовали к мРНК Gapdh , измеренной в каждом образце.Альтернативно, ОТ-ПЦР выполняли с использованием зонда Fast TaqMan (Applied Biosystems) и соответствующего анализа TaqMan (Applied Biosystems) в термоциклере 7900 Fast Real Time. Относительную экспрессию мРНК нормализовали к мРНК 18s, измеренной в каждом образце, или к мРНК Hprt при анализе щитовидной железы. Используемые праймеры и тесты TaqMan указаны в дополнительной таблице 2.

Иммуноокрашивание UCP1 и конфокальный анализ

Для иммуноокрашивания UCP1 свежие жировые отложения фиксировали 10% формалином, включали в парафин, разрезали на 5-миллиметровые слайды и последовательно окрашивали антитело UCP1 (1/500, Abcam cat # AB10983), биотинилированное козье вторичное антитело против кролика (1/500, Jackson Immuno Research Laboratories), комплекс ABC, конъюгированный со стрептавидином, и субстрат, конъюгированный с 3,3'-диаминобензиденом пероксидазой хрена (Vector Laboratories, кат. № PK-6100) с последующим кратковременным контрастным окрашиванием гематоксилином Nuclear Fast Red (Sigma).

В качестве альтернативы адипоциты окрашивали первичным антителом UCP1 (1/500, Abcam cat # AB10983) вместе с флуоресцентным козьим вторичным антителом против кролика (Invitrogen), Bodipy (Invitrogen) и Dapi (Invitrogen) для изучения экспрессии UCP1. Изображения получали с помощью конфокального микроскопа Leica SPE (Leica Microsystems, Вецлар, Германия).

Для анализа организации митохондрий адипоциты окрашивали Mito Tracker Deep Red (Invitrogen) и Bodipy (Invitrogen).

Анализ морфологии митохондрий

Отложения свежего жира размером 1 мм 2 были зафиксированы смесью 4% параформальдхейда и 2% глутаралдхейда в 0.4 M hepes-буфер в течение 4 ч при 4 ° C. После фиксации образцы промывали 0,4 М буфером hepes и анализировали в просвечивающем электронном микроскопе (JEOL 1230), связанном с камерой TVIPS CMOS 4K. Снимки получены при 80 кВ.

Анализ иммунопреципитации хроматина

Иммортализованные белые преадипоциты дикого типа и Mkk6 - / - мышей дифференцировали на адипоциты в течение 9 дней и обрабатывали для экстракции хроматина в соответствии с набором SimpleChIP ® Plus от Cell Signaling.Хроматин иммунопреципитировали с помощью антитела THRα / THRβ (C3) (ThermoScientific, номер по каталогу MA1-215), и после элюирования и очистки ДНК анализировали с помощью qRT-PCR с использованием праймеров-энхансеров UCP1 (fw: TCTACAGCGTCACAGAGGGT, rv: TGATTTCTGCTCA primer). против интрона 2 RPL30, поставляемого SimpleChIP ® Plus Kit. Результаты выражаются в процентах от ввода.

Измерение уровней циркулирующих гормонов

Т3, Т4 и ТТГ были количественно определены в сыворотке с помощью мультиплексного ELISA с анализатором Luminex 200 (Bio-Rad) в соответствии с инструкциями производителя.

Статистический анализ

Результаты выражены в виде среднего значения ± SEM. Статистический анализ оценивали с помощью критерия Стьюдента t и двухфакторного дисперсионного анализа со значениями p <0,05, считающимися значимыми.

Доступность данных

Авторы заявляют, что все данные, подтверждающие выводы этого исследования, доступны в документе и файлах с дополнительной информацией или могут быть предоставлены авторами по разумному запросу.

Дифференциальные роли MAPK-киназ MKK3 и MKK6 в остеокластогенезе и потере костной ткани

Abstract

Костная масса поддерживается остеокластами, резорбирующими кости, и остеобластами, которые способствуют отложению матрикса и минерализации.Гомеостаз кости нарушается при хроническом воспалении, а также при потере эстрогена в постменопаузе, что способствует активности остеокластов, что приводит к остеопорозу. MAPK p38α является ключевым регулятором потери костной массы, а ингибиторы p38 сохраняют костную массу, подавляя остеокластогенез. Функция p38 регулируется двумя вышестоящими киназами MAPK, а именно MKK3 и MKK6. Целью этого исследования было оценить влияние дефицита MKK3 или MKK6 на остеокластогенез in vitro и на потерю костной массы при остеопорозе, вызванном овариэктомией, у мышей.Мы продемонстрировали, что MKK3, но не MKK6, регулирует дифференцировку остеокластов из клеток костного мозга in vitro. Экспрессия NFATc1, главного фактора транскрипции в остеокластогенезе, снижена в клетках, лишенных MKK3, но не MKK6. Экспрессия генов, специфичных для остеокластов, катепсина К, рецептора, ассоциированного с остеокластами, и MMP9 ингибировалась в клетках MKK3 - / -. Затем влияние MKK-дефицита на вызванную овариэктомией потерю костной массы оценивали у самок мышей WT, MKK3 - / - и MKK6 - / - с помощью анализа микро-CT.Потеря костной массы частично ингибировалась у мышей MKK3 - / -, а также MKK6 - / -, несмотря на нормальный остеокластогенез в клетках MKK6 - / -. Это коррелировало с более низким числом остеокластов у мышей с недостаточностью MKK, подвергнутых овариэктомии. Эти исследования показывают, что MKK3 и MKK6 по-разному регулируют потерю костной массы из-за отмены эстрогена. MKK3 непосредственно опосредует остеокластогенез, тогда как MKK6, вероятно, способствует выработке провоспалительных цитокинов, которые способствуют образованию остеокластов.

Образец цитирования: Boyle DL, Hammaker D, Edgar M, Zaiss MM, Teufel S, David JP, et al.(2014) Дифференциальная роль киназ MAPK MKK3 и MKK6 в остеокластогенезе и потере костной ткани. PLoS ONE 9 (1): e84818. https://doi.org/10.1371/journal.pone.0084818

Редактор: Доминик Хейманн, Нантский медицинский факультет, Франция

Поступила: 10 сентября 2013 г .; Принята к печати: 21 ноября 2013 г .; Опубликовано: 6 января 2014 г.

Авторские права: © 2014 Boyle et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: При поддержке NIH гранты AI-070555 и AI-067752. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Гомеостатическое поддержание костной массы и прочности требует согласованных действий костеобразующих остеобластов и костно-резорбирующих остеокластов [1].Дисбаланс в ремоделировании костей, который способствует дифференцировке, выживанию и активации остеокластов, возникает при хронических воспалительных заболеваниях, таких как ревматоидный артрит (РА), а также при постменопаузальном остеопорозе [2], [3]. Провоспалительные цитокины, такие как IL-1, TNF и IL-6, при хроническом воспалении или потере эстрогена в менопаузе регулируют резорбцию кости за счет увеличения экспрессии активатора рецептора лиганда NF-κB (RANKL) на остеобластах и ​​стромальных клетках или путем усиления RANKL-опосредованной дифференцировки моноцитов в остеокласты [4] - [7].Взаимодействие RANKL с его родственным рецептором RANK, экспрессируемым на остеокластах, инициирует передачу сигналов, которая усиливает активность остеокластов, что приводит к ускоренной потере костной массы и переломам [8].

RANK и RANKL относятся к суперсемейству рецепторов TNF [9], [10]. Связывание RANKL с RANK рекрутирует фактор-6, связанный с адаптерным белком TNF-рецептором (TRAF6), на плазматическую мембрану [11]. RANK, RANKL и TRAF6 важны для остеокластогенеза, поскольку мыши, лишенные этих молекул, имеют глубокие дефекты резорбции кости [11].Комплекс RANK / TRAF6 активирует несколько путей, включая NF-κB и MAPK, JNK и p38, которые индуцируют экспрессию NFATc1, который считается одним из главных факторов транскрипции остеокластогенеза [12], [13]. NFATc1 в сочетании с факторами транскрипции AP-1, PU.1 и фактором транскрипции микрофтальмии (MITF) необходим для экспрессии специфичных для остеокластов генов, таких как тартрат-резистентная кислая фосфатаза (TRAP) и катепсин K, которые способствуют резорбции костей и деминерализация [14], [15].

Семейство p38 MAPKs, в первую очередь p38α, является важным регулятором RANKL-опосредованного остеокластогенеза, что делает его потенциальной терапевтической мишенью для остеопороза [16]. Несколько исследований показали, что ингибиторы p38 предотвращают воспалительную деструкцию костей на животных моделях и в некоторых случаях обращают вспять существующее заболевание [17] - [19]. Киназы MAPK, MKK3 и MKK6, являются двумя вышестоящими ферментами, которые по-разному регулируют функцию p38 [20]. Наши предыдущие исследования показали, что MKK3 необходим для оптимальной активации p38α, тогда как MKK6 регулирует продукцию провоспалительных цитокинов в ответ на LPS и TNF [21].Кроме того, дефицит MKK3 или MKK6 снижает тяжесть артрита и разрушение суставов при артрите K / BxN с пассивным переносом сыворотки или артрите, индуцированном коллагеном [21] - [23]. Целью этого исследования было оценить роль MKK3 и MKK6 в p38-регулируемой резорбции кости. Поэтому мы оценили влияние дефицита MKK3 и MKK6 на остеокластогенез in vitro и на сохранение костей in vivo с использованием модели остеопороза при овариэктомии. Эти исследования показывают, что блокирование MKK3 или MKK6 оказывает благотворное влияние на сохранение костей за счет дифференциальной регуляции остеокластогенеза или функции.

Материалы и методы

Мыши

Самки мышей C57Bl / 6 дикого типа (WT) (возраст 6-8 недель) были приобретены в Charles River Laboratories (Уилмингтон, Массачусетс). Самки мышей MKK3 - / - и MKK6 - / - (фон C57Bl / 6) были получены от доктора Ричарда Флавелла (Йельский университет, Коннектикут).

Заявление об этике

Все протоколы экспериментальных животных были рассмотрены и одобрены Комитетом по институциональному уходу и использованию животных Калифорнийского университета в Сан-Диего. Это исследование было проведено в строгом соответствии с рекомендациями Руководства по уходу и использованию лабораторных животных Национального института здоровья.Все операции проводились под испарителем изофлурана, и все усилия были направлены на то, чтобы свести к минимуму страдания. Мышей содержали в стандартных условиях содержания и позволяли им иметь неограниченный доступ к пище и воде.

Поколение остеокластов

Костный мозг выделяли из бедренных и большеберцовых костей WT, MKK3 - / - и MKK6 - / -. Эритроциты лизировали, а оставшиеся клетки подсчитывали и высевали в колбы Т75 из расчета 1 × 10 6 клеток / мл. Клетки культивировали в течение 24 часов в αMEM (1X), содержащем GlutaMAX (Invitrogen, Carlsbad, CA) с добавлением 10% FBS, 5% пенициллин-стрептомицина и 30 нг / мл рекомбинантного мышиного M-CSF (Peprotech, Rocky Hill, Нью-Джерси).Через 24 часа неприлипшие клетки высевали в 24-луночные планшеты (1 × 10 6 клеток / мл) с 30 нг / мл M-CSF и 50 нг / мл активатора рецептора лиганда NF-κB ( RANKL) (НИОКР, Миннеаполис, Миннесота). Культуральную среду заменяли каждые 72 часа и добавляли M-CSF и RANKL в течение 5-8 дней, пока не наблюдались многоядерные остеокласты. В некоторых экспериментах клетки культивировали в течение 5 дней с 3 мкМ SB203580 (ингибитор р38) или ДМСО (EMD Chemicals, Гиббстаун, Нью-Джерси).

Дифференциация и активность остеокластов

Окрашивание тартрат-устойчивой кислой фосфатазой (TRAP): дифференцированные клетки окрашивали с использованием набора Acid Phosphatase, Leukocyte (TRAP) (Sigma-Aldrich, St.Луис, Миссури). Остеокласты определяли как многоядерные (≥3 ядер) TRAP-положительные клетки и подсчитывали в 5 заранее определенных местах в каждой лунке. Данные представлены как среднее количество в каждой лунке.

Анализ резорбции костной ткани: Моноциты костного мозга (BMM) высевали по 3 × 10 5 клеток / лунку в течение 8 дней в системе культуры костных клеток Osteologic ™ (BD Biocoat ™, Бедфорд, Массачусетс) (4). Затем систему культивирования клеток подвергали окрашиванию по фон Коссу. Были визуализированы восемь определенных областей каждой лунки, и ямы резорбции были количественно определены с использованием программного обеспечения Image Pro Plus (Media Cybernetics, Bethesda, MD).Среднюю резорбцию рассчитывали на площадь для каждой лунки, и данные выражали как процент резорбированной площади / общей площади.

Овариэктомия

В возрасте 16 недель самок мышей WT, MKK3 - / - и MKK6 - / - подвергали овариэктомии или фиктивной хирургии и позволяли им восстановиться в течение 6 недель. Для подтверждения овариэктомии уровень лейтинизирующего гормона (ЛГ) измеряли в сыворотке с помощью сэндвич-ELISA (анализ лигандов и основная лаборатория анализа в Университете Вирджинии).

Микрокомпьютерная томография (микро-КТ) и гистоморфометрия костей

Микро-КТ изображений большеберцовой кости были получены, как описано ранее [13].Вкратце, большеберцовые кости собирали, фиксировали в 10% нейтральном забуференном формалине в течение 24 часов и хранили в 70% этаноле. Все количественные оценки были выполнены с помощью анализа цифровых изображений (OsteoMeasure; Osteometrics, Атланта, Джорджия). Были измерены следующие параметры: доля объема кости от общего объема образца (объем кости / объем ткани (BV / TV)), число трабекул (Tb.N), толщина трабекул (Tb.Th) и разделение трабекул (Tb. Sp).

Гистоморфометрический анализ проводили на некальцифицированных пластиковых срезах кости, залитых метакрилатом, и окрашивали с использованием красителя фон Коссы и красителя TRAP.Для измерения скорости образования костной ткани (BFR) всем мышам вводили раствор кальцеина зеленого (30 мг / кг, Sigma, Миссури) за 10 и 2 дня до сбора урожая. Большеберцовые кости были подготовлены, как описано выше, измерения были выполнены с использованием системы анализа изображений (OsteoMeasure), была рассчитана скорость образования кости, и данные представлены как мкм 3 / мкм 2 / год.

Анализ экспрессии гена

Тотальную РНК выделяли из клеток, и 500 нг РНК использовали для синтеза первой цепи кДНК (Life Technologies, NY).Количественную ПЦР в реальном времени проводили с использованием наборов праймеров / зондов для анализа экспрессии генов Taqman и системы GeneAmp 7300 (Applied Biosystems, Foster City, CA) [24]. Значения Ct нормализовали по гипоксантин-гуанинфосфорибозилтрансферазе 1 (Hprt1) с использованием метода ΔΔCt.

Вестерн-блоттинг

Остеокласты лизировали с использованием буфера для лизиса, содержащего 50 мМ HEPES (pH 7,4), 150 мМ NaCl, 25 мМ MgCl 2 , 1 мМ EDTA (pH 8,0), 10% глицерина, 1% Triton X-100, 20 мМ ß-глицерофосфат, 10 мМ NaF, 1 мМ Na 2 VO 4 , 0.4% коктейльный ингибитор протеазы (Roche, Indianapolis, IN). Белок количественно определяли с помощью набора для анализа белков Micro BCA (Thermo Scientific, Waltham, MA), разделяли с помощью полиакриламидного геля Nupage® Bis-Tris 4–12% (Invitrogen) и переносили на мембрану из ПВДФ. Мембрану зондировали антителами, специфичными к фосфо-p38 мыши (Sigma), общему p38 (Cell Signaling Technology, Danvers, MA) и актину (Sigma, MO). Вестерн-блоттинг проводили с использованием набора Immun-star ™ Western C Kit, а изображения анализировали с использованием системы Versadoc Imaging System и программного обеспечения Quantity One (Bio-Rad Laboratories, Hercules, CA).

Статистический анализ

Сравнения между клетками WT, MKK3 - / - и MKK6 - / - анализировали с помощью однофакторного дисперсионного анализа и тестов множественного сравнения Тьюки или Крускала-Уоллиса, если не указано иное. Данные овариэктомии анализировали с помощью двухфакторного дисперсионного анализа и теста множественного сравнения Тьюки. Данные анализировали с помощью GraphPad Prism 6.0, и сравнения считали статистически значимыми, если p <0,05.

Результаты

Влияние дефицита MKK3 и MKK6 на остеокластогенез in vitro

Чтобы оценить роль MKK3 и MKK6 в дифференцировке остеокластов, мы культивировали WT и MKK3- и MKK6-дефицитные клетки костного мозга в присутствии M-CSF и RANKL.Клетки WT культивировали в присутствии или в отсутствие ингибитора p38 SB203580 (SB). Остеокластогенез был значительно снижен в группе WT, получавшей MKK3 - / - (p = 0,0012) и SB (p <0,0001), по сравнению с контролем WT (рис. 1A, n = 3 мыши / группа). Количество остеокластов MKK3 - / - также было значительно ниже, чем количество клеток MKK6 - / - (p = 0,0012). Удивительно, но количество остеокластов в группе MKK6 - / - было сопоставимо с контролем WT. Затем мы определили уровень фосфорилирования p38 (P-p38) в культивируемых остеокластах WT, MKK3 - / - и MKK6 - / - с помощью вестерн-блоттинга.Клетки MKK3 - / - имели значительно сниженные уровни P-p38 по сравнению с WT или MKK6 - / - (Рисунок 1B, p = 0,0009 и p = 0,005, соответственно). Эти данные показывают, что MKK3, но не MKK6, является важным регулятором дифференцировки остеокластов in vitro.

Рисунок 1. Влияние дефицита MKK на остеокластогенез in vitro.

(A) Клетки костного мозга WT, MKK3 - / - и MKK6 - / - культивировали для индукции остеокластогенеза и анализировали с помощью окрашивания TRAP (n = 3 / группа). Количество остеокластов подсчитывали в 5 заранее определенных местах на лунку, и данные представляли как среднее значение ± стандартная ошибка среднего.Количество остеокластов было уменьшено в клетках WT, обработанных SB, и в клетках MKK3 - / - по сравнению с WT. Остеокластогенез в группе MKK6 - / - был сопоставим с клетками WT. * p <0,05 (B) Фосфорилирование p38 в MKK-дефицитных остеокластах. Вестерн-блоттинг показал, что уровни P-p38 были значительно ниже в MKK3 - / -, но не в MKK6 - / - по сравнению с группой WT. * р <0,05.

https://doi.org/10.1371/journal.pone.0084818.g001

Активность резорбции кости в MKK3- и MKK6-дефицитных остеокластах

Костная резорбция остеокластов с дефицитом MKK была затем определена по их способности деминерализовать матрикс и образовывать резорбционные ямки.Резорбцию визуализировали с помощью окрашивания по фон Коссу (рис. 2). Остеокласты MKK3 - / - имели значительно меньшее количество резорбтивных ямок, чем клетки WT (p = 0,0061) или MKK6 - / - (p = 0,027, тест Краскела-Уоллиса), что позволяет предположить, что MKK3 является ключевым регулятором дифференцировки остеокластов in vitro.

Рисунок 2. Резорбция кости остеокластами с дефицитом MKK3 и MKK6.

Клетки костного мозга WT, MKK3 - / - и MKK6 - / - дифференцировали в остеокласты на кальциевой матрице и подвергали окрашиванию по Фон Коссу для определения активности резорбции.Площадь резорбционной ямы рассчитывалась для восьми участков на лунку, и данные представлены как процент резорбированной площади / общей площади. Резорбционная активность была значительно снижена в остеокластах MKK3 - / -, но не в MKK6 - / -, по сравнению с WT. n = 3 / группа, * p <0,05.

https://doi.org/10.1371/journal.pone.0084818.g002

Экспрессия гена

в остеокластах MKK3 - / - и MKK6 - / -

Дифференциация остеокластов требует экспрессии ряда хорошо охарактеризованных маркеров, таких как NFATc1 и катепсин К, которые регулируют функцию остеокластов.Чтобы определить влияние дефицита MKK на эти маркеры, мы сравнили экспрессию генов в остеокластах WT, MKK3 - / - и MKK6 - / - с помощью qPCR (рис. 3). Экспрессия катепсина К и остеокласт-ассоциированного рецептора (OSCAR) была значительно снижена в остеокластах MKK3 - / - по сравнению с WT (p <0,001, соответственно) или MKK6 - / - клетками (p <0,001, соответственно). Точно так же экспрессия NFATc1 была значительно снижена в MKK3 - / - клетках по сравнению с WT (p = 0,004) или MKK6 - / - остеокластами (p = 0,009). Экспрессия c-fos и MMP9 (желатиназа B) подавлялась только в клетках MKK3 - / - (p = 0.037 и p = 0,031 соответственно, t-критерий) по сравнению с WT. Напротив, экспрессия RANK не снижалась в MKK-дефицитных клетках. Эти данные показывают, что экспрессия остеокласт-специфических маркеров in vitro ингибируется в отсутствие MKK3.

Рисунок 3. Экспрессия генов в остеокластах MKK3 - / - и MKK6 - / -.

WT, MKK3 - / - и MKK6 - / - РНК остеокластов выделяли и подвергали кПЦР с использованием наборов ген-специфичных праймерных зондов (n = 3 / группа). Экспрессия NFATc1, cFos, катепсина K, OSCAR и MMP9 была значительно ниже в клетках MKK3 - / -, но не MKK6 - / -, по сравнению с WT.Экспрессия RANK была сопоставима в группах WT, MKK3 - / - и MKK6 - / -. * р <0,05.

https://doi.org/10.1371/journal.pone.0084818.g003

Потеря костной массы, вызванная овариэктомией у мышей с дефицитом MKK3 и MKK6

Потеря эстрогена у мышей после овариэктомии (OVX) связана с повышенным метаболизмом костной ткани, при этом резорбция кости превышает образование, что приводит к чистой потере костной массы. На данный момент наши данные показали, что дефицит MKK3 снижает остеокластогенез и резорбцию кости in vitro, указывая тем самым, что недостаток MKK3 может сохранять кости in vivo.Поэтому мы исследовали влияние дефицита MKK на сохранение костной ткани после овариэктомии. Эффективность операции была подтверждена повышенным уровнем лютеинизирующего гормона (ЛГ) в послеоперационных сыворотках (Рисунок S1). Плотность трабекулярной кости в проксимальной части большеберцовой кости оценивали у мышей OVX или фиктивных контрольных мышей с помощью микро-КТ (рис. 4A, n = 5 / группа).

Рисунок 4. Потеря костной массы, вызванная овариэктомией, у мышей MKK3 - / - и MKK6 - / -.

(A) Мышей WT, MKK3 - / - и MKK6 - / - подвергали овариэктомии, и потерю костной массы рассчитывали с помощью анализа микро-КТ (n = 5 / группа).Показаны репрезентативные изображения. Значительная потеря костной массы наблюдалась во всех трех группах. (B) Объем костей и количество трабекул были увеличены у мышей, ложно обработанных MKK3 - / - и MKK6 - / -, или мышей OVX по сравнению с соответствующими контролями WT. Толщина трабекул была сходной у мышей, подвергнутых ложному лечению, и мышей OVX. Разделение трабекул было значительно выше у мышей WT и MKK3 - / - после OVX. MKK3- и MKK6-дефицитные мыши имели фенотип с высокой костной массой по сравнению с дикими мышами в группах фиктивного лечения или OVX.

https: // doi.org / 10.1371 / journal.pone.0084818.g004

Микро-КТ анализ показал значительно более высокий объем кости (BV / TV) и трабекулярное число (Tb.N.) у фиктивных мышей MKK3 - / - по сравнению с фиктивным контролем WT (рис. 4B, BV: p = 0,003, Tb.N: p = 0,006). Удивительно, но фиктивные мыши MKK6 - / - имели значительно увеличенный объем кости и Tb.N. по сравнению с фиктивным контролем WT (BV: p <0,0001, Tb.N: p <0,0001). Вместе эти данные предполагают, что как MKK3, так и MKK6 играют роль в физиологическом гомеостазе костей. В то время как значительная потеря костной массы наблюдалась после OVX для всех трех генотипов, объема кости и Tb.N было умеренно повышено у мышей OVX MKK3 - / - и значительно увеличилось у мышей MKK6 - / - по сравнению с контролем OVX WT. Эти результаты предполагают, что мыши MKK6 - / - были частично защищены от опосредованной OVX потери костной массы, поддерживая объем кости, аналогичный контрольным WT, получавшим фиктивную терапию. Толщина трабекул практически не изменилась у мышей OVX или фиктивного контроля WT и MKK - / -. Напротив, разделение трабекул (Tb. Sp) было значительно выше после OVX у WT (p = 0,002) и MKK3 - / - (p = 0,005), но не у MKK6 - / -, по сравнению с их соответствующими фиктивными контролями.Разделение трабекул было значительно ниже у мышей OVX MKK3 - / - (p = 0,003) и MKK6 - / - (p <0,0001) по сравнению с мышами OVX WT, что указывает на более высокую костную массу у мышей с дефицитом MKK. Вместе данные in vivo демонстрируют, что дефицит MKK3 и MKK6 связан с фенотипом с высокой костной массой, который частично сохраняется после OVX.

Гистоморфометрический анализ костей у мышей, подвергнутых овариэктомии MKK3- и MKK6-дефицитных

Для дальнейшей оценки эффекта MKK3- и MKK6-дефицита у мышей с дефицитом эстрогена, некальцифицированные срезы большеберцовой кости мышей OVX и фиктивных контрольных мышей окрашивали и подвергали гистоморфометрическому анализу (рис. 5A, B).В соответствии с данными микро-КТ, объем кости (% BV / TV) был значительно выше у мышей MKK3 - / -, обработанных ложным и OVX (p <0,05 для каждого) и MKK6 - / -, по сравнению с соответствующими контрольными WT (p <0,001 для каждого). OVX приводил к уменьшению объема кости в группах WT, MKK3 - / - и MKK6 - / - (n = 5 / лечение, p <0,001, соответственно). Тем не менее, объем кости и количество трабекул сохранялись, по крайней мере, частично у MKK-мутантов, что указывает на такой же объем кости после OVX, что и у мнимо обработанных мышей WT. Толщина трабекул (Tb.Th) был сходным у мышей WT, MKK3 - / - и MKK6 - / - как после фиктивной обработки, так и после OVX.

Рисунок 5. Гистоморфометрический анализ кости у мышей MKK3 - / - и MKK6 - / - после удаления яичников.

(A) Срезы большеберцовой кости от ложных мышей и мышей, обработанных OVX, были окрашены и показаны репрезентативные цифры (n = 5 / группа) (B) Гистоморфометрический анализ показал, что объем кости и количество трабекул были увеличены у мышей MKK6 - / - по сравнению с с WT после ложной операции или OVX. Толщина трабекул не изменилась после OVX в трех группах.Окрашивание TRAP показало более низкое количество остеокластов (NOc / B.Pm) после OVX у MKK3 - / - и MKK6 - / - по сравнению с мышами WT. Количество остеобластов не изменилось после OVX в трех группах. (C) Скорость образования костной ткани оценивали путем инъекции мышам зеленого раствора кальцеина за 10 и 2 дня до сбора урожая. Большеберцовые кости оценивали на скорость образования кости (n = 3 / группа). Скорость образования костей не изменилась из-за дефицита MKK у мышей, получавших фиктивную или OVX, по сравнению с контрольными мышами дикого типа. * р <0,05.

https: // doi.org / 10.1371 / journal.pone.0084818.g005

Окрашивание TRAP показало более высокое количество остеокластов (NOc / периметр кости) у мышей WT OVX по сравнению с мышами WT, получавшими ложную терапию (p <0,001). Однако мыши с дефицитом MKK3 и MKK6 имели значительно меньшее количество остеокластов по сравнению с мышами, получавшими фиктивную терапию или мышами дикого типа OVX (MKK3 - / -: p <0,01, MKK6 - / -: p <0,001). Интересно, что количество остеобластов (NOb) и скорость образования кости не изменились у мутантов MKK3 и MKK6. Эти результаты предполагают, что дефицит MKK ингибирует образование остеокластов in vivo, но не изменяет количество остеобластов или образование кости (рис. 5C).Вместе эти данные показывают, что дефицит MKK вызывает высокую костную массу за счет снижения количества остеокластов in vivo.

Обсуждение

Дифференцировка и активация остеокластов регулируется p38 MAPK, по крайней мере частично, опосредуя эффекты провоспалительных цитокинов [25], [26]. Несколько исследований показали, что ингибиторы p38 защищают от резорбции костей при воспалении, возможно, за счет прямого воздействия на остеокласты, а также за счет ингибирования экспрессии цитокинов, индуцированной p38.Например, активация p38α важна для TNF-опосредованной воспалительной потери костной массы, а селективный ингибитор p38α предотвращает потерю трабекулярной кости и увеличение площади кортикальной кости у крыс с удаленными яичниками [13], [27]. Наши предыдущие исследования продемонстрировали клинические преимущества дефицита MKK3 и MKK6 в моделях острого и хронического артрита [21] - [23]. Вызванная воспалением потеря костной массы в суставах была заметно снижена в отсутствие MKK3 или MKK6 с соответствующим снижением сывороточного IL-6 и синовиального MMP [22].В настоящем исследовании мы расширяем наши наблюдения за защитой костей, оценивая влияние дефицита MKK3 и MKK6 на остеокластогенез и потерю костной массы из-за отмены эстрогена у овариэктомированных мышей.

Наши данные показывают, что MKK3 и MKK6 по-разному регулируют остеокластогенез. MKK3 необходим для оптимального остеокластогенеза и функционирования. MKK6 не смог эффективно компенсировать отсутствие MKK3 в остеокластах. С другой стороны, дефицит MKK6 не влияет на остеокластогенез in vitro.В соответствии с нашими предыдущими исследованиями, уровни P-p38 были заметно снижены в MKK3 - / -, но нормальны в MKK6 - / - остеокластах [21]. Количество остеокластов и активность резорбции коррелировали с активацией p38 в MKK3 - / - и MKK6 - / - клетках и согласуются с предыдущими исследованиями [16]. Экспрессия NFATc1 и c-fos была снижена в остеокластах MKK3 - / -, указывая на то, что функция p38 необходима для индукции этих факторов транскрипции, которые участвуют в дифференцировке остеокластов [28]. Экспрессия катепсина K, OSCAR и матриксной металлопротеиназы 9 (MMP9) была снижена в остеокластах с дефицитом MKK3.Это согласуется с необходимостью NFATc1 для транскрипции этих специфичных для остеокластов маркеров [15], [29], [30]. Вместе эти результаты показывают, что MKK3, а не MKK6, является основным регулятором индуцированной RANKL передачи сигналов в остеокластогенезе in vitro. Эти данные согласуются с другими исследованиями, показывающими, что p38 регулирует ранние фазы дифференцировки остеокластов [31], [32]. Однако эти исследования показали, что MKK6, но не MKK3, необходим для остеокластогенеза in vitro, где он увеличивает выживаемость клеток, но не резорбцию кости.Различия могут быть частично связаны с различиями в методологии, такими как эффективность ингибирования MKK3 и MKK6 с использованием вирусной трансдукции доминантно-негативных конструкций MKK3 и MKK6 по сравнению с использованием остеокластов MKK3 - / - и MKK6 - / -, полученных из костного мозга. мышей.

Остеокластогенез in vivo регулируется рядом факторов, таких как витамин D, паратироидный гормон, простагландины и, в первую очередь, эстроген [33] - [36]. Эстроген является ключевым модулятором как иммунной системы, так и гомеостаза костей [37].Он регулирует ремоделирование костей, уменьшая продолжительность жизни остеокластов, способствуя апоптозу [38], [39]. Эстроген подавляет экспрессию RANKL на остеобластах, стромальных клетках и лимфоцитах и ​​увеличивает продукцию остеопротегерина (OPG), ингибитора передачи сигналов RANK [1]. В период менопаузы потеря эстрогена связана с повышенными уровнями IL-1, IL-6, TNF и M-CSF, которые поддерживают резорбцию кости [40], [41]. Дефицит эстрогена также запускает дифференцировку клеток Th27, которые продуцируют провоспалительный цитокин IL-17 [42].IL-17 индуцирует продукцию IL-6 и TNF остеобластами и стромальными клетками, которые вызывают экспрессию RANKL, ускоряют остеокластогенез и приводят к остеопорозу [43].

В этом исследовании мы показали, что дефицит как MKK3, так и MKK6 связан с высокой костной массой и, по крайней мере, частично ингибирует потерю костной массы после овариэктомии, хотя наши исследования in vitro не показали серьезных эффектов MKK6 на остеокластогенез in vitro. Гистоморфометрические данные продемонстрировали, что высокая костная масса при дефиците MKK3 и MKK6 коррелирует со снижением количества остеокластов.Уменьшение количества остеокластов у мышей с дефицитом MKK6 могло быть связано со снижением продукции цитокинов, регулируемых p38, таких как IL-6, поскольку прямого воздействия на остеокласты не наблюдалось. Защита костей согласуется с нашими предыдущими исследованиями, показывающими уменьшение воспаления и разрушения суставов у мышей MKK3 - / - и MKK6 - / -, где было обнаружено прямое действие на остеокласты для MKK3 и косвенное действие путем блокирования цитокинов для MKK6 [22].

Исследование также не обнаружило значительного влияния на количество остеобластов и скорость образования кости у мышей с дефицитом MKK3 и MKK6.Регуляция костного гомеостаза и формирования скелета была недавно оценена на MKK3- и MKK6-дефицитных мышах [44]. Это исследование показало, что мыши MKK3 - / - и MKK6 - / - имели сниженную костную массу в результате дефектной дифференцировки остеобластов. Причина несоответствия неясна, но отчасти может быть из-за разницы в штамме мышей и разного возраста использованных мышей: 5 недель по сравнению с 20 неделями в нашем исследовании.

В заключение, MKK3 и MKK6 влияют на костную массу посредством регуляции количества остеокластов in vivo.MKK6 и, в меньшей степени, MKK3 уменьшают потерю костной массы в сочетании с дефицитом эстрогена. В то время как MKK3, вероятно, опосредует прямые эффекты на остеокласты через передачу сигналов RANKL, MKK6, вероятно, способствует выработке провоспалительных цитокинов, таких как IL-6 и IL-17, которые увеличивают экспрессию RANKL. Нацеливание на вышестоящие киназы p38, такие как MKK3 и MKK6, может модулировать потерю костной массы во время воспаления и дефицита эстрогена.

Вспомогательная информация

Рисунок S1.

Лейтинизирующий гормон сыворотки (ЛГ) у мышей, подвергшихся овариэктомии. Эффективность овариэктомии оценивалась путем измерения ЛГ в сыворотке крови. Уровни ЛГ были значительно повышены в сыворотках WT, подвергнутых овариэктомии, MKK3 - / - и MKK6 - / - по сравнению с сыворотками, обработанными ложно (n = 8 / группа, * p <0,05).

https://doi.org/10.1371/journal.pone.0084818.s001

(TIF)

Благодарности

Авторы благодарят доктора Памелу Меллон и доктора Кристину Глайдвелл-Кенни за советы по операциям по удалению яичников и за подтверждение ЛГ.

Вклад авторов

Задумал и спроектировал эксперименты: DLB GS GSF.Проведены опыты: МЭ ММЗ СТ. Проанализированы данные: DLB DH ME JD GS GSF. Внесенные реактивы / материалы / инструменты анализа: MMZ ST JD GS. Написал статью: DH DLB JD GS GSF.

Список литературы

  1. 1. Хосла С. (2001) Миниобзор: система OPG / RANKL / RANK. Эндокринология 142: 5050–5055.
  2. 2. Kimble RB, Srivastava S, Ross FP, Matayoshi A, Pacifici R (1996) Дефицит эстрогена увеличивает способность стромальных клеток поддерживать остеокластогенез мышей через опосредованную интерлейкином-1 и фактором некроза опухоли стимуляцию выработки макрофагального колониестимулирующего фактора.J Biol Chem 271: 28890–28897.
  3. 3. Manolagas SC (1995) Роль цитокинов в резорбции кости. Кость 17: 63S – 67S.
  4. 4. Wei S, Kitaura H, Zhou P, Ross FP, Teitelbaum SL (2005) IL-1 опосредует индуцированный TNF остеокластогенез. Дж. Клин Инвест 115: 282–290.
  5. 5. Kim JH, Jin HM, Kim K, Song I, Youn BU и др. (2009) Механизм дифференцировки остеокластов, индуцированный IL-1. J Immunol 183: 1862–1870.
  6. 6. Faienza MF, Ventura A, Marzano F, Cavallo L (2013) Постменопаузальный остеопороз: роль клеток иммунной системы.Clin Dev Immunol 2013: 575936.
  7. 7. Дэвид JP, Schett G (2010) TNF и кость. Curr Dir Autoimmun 11: 135–144.
  8. 8. Feng X (2005) RANKing внутриклеточной передачи сигналов в остеокластах. IUBMB Life 57: 389–395.
  9. 9. Раггатт LJ, Партридж NC (2010) Клеточные и молекулярные механизмы ремоделирования кости. J Biol Chem 285: 25103–25108.
  10. 10. Бойл В.Дж., Симонет В.С., Лейси Д.Л. (2003) Дифференциация и активация остеокластов.Природа 423: 337–342.
  11. 11. Асагири М., Такаянаги Х. (2007) Молекулярное понимание дифференциации остеокластов. Bone 40: 251–264.
  12. 12. Strait K, Li Y, Dillehay DL, Weitzmann MN (2008) Подавление активации NF-kappaB блокирует резорбцию остеокластической кости во время дефицита эстрогена. Int J Mol Med 21: 521–525.
  13. 13. Zwerina J, Hayer S, Redlich K, Bobacz K, Kollias G, et al. (2006) Активация p38 MAPK является ключевым этапом в воспалительной деструкции кости, опосредованной фактором некроза опухоли.Arthritis Rheum 54: 463–472.
  14. 14. Шарма С.М., Брониш А., Ху Р., Патель К., Мански К.С. и др. (2007) MITF и PU.1 рекрутируют p38 MAPK и NFATc1 для нацеливания на гены во время дифференцировки остеокластов. J Biol Chem 282: 15921–15929.
  15. 15. Troen BR (2006) Регулирование экспрессии гена катепсина К. Ann N Y Acad Sci 1068: 165–172.
  16. 16. Бом Ч., Хайер С., Килиан А., Заисс М.М., Фингер С. и др. (2009) Альфа-изоформа p38 MAPK специфически регулирует потерю костной массы при артрите.J Immunol 183: 5938-5947.
  17. 17. Хилл Р.Дж., Даббаг К., Фиппард Д., Ли К., Саттманн Р.Т. и др. (2008) Pamapimod, новый ингибитор митоген-активируемой протеинкиназы p38: доклинический анализ эффективности и селективности. J Pharmacol Exp Ther 327: 610–619.
  18. 18. Каверзасио Дж., Хиггинс Л., Амманн П. (2008) Предотвращение потери трабекулярной кости, вызванной дефицитом эстрогена, с помощью селективного ингибитора альфа-альфа. J Bone Miner Res 23: 1389–1397.
  19. 19. Medicherla S, Ma JY, Mangadu R, Jiang Y, Zhao JJ и др.(2006) Селективный ингибитор протеинкиназы, активируемой митогеном p38-альфа, обращает вспять разрушение хрящей и костей у мышей с индуцированным коллагеном артритом. J Pharmacol Exp Ther 318: 132–141.
  20. 20. Inoue T, Hammaker D, Boyle DL, Firestein GS (2005) Регулирование p38 MAPK с помощью MAPK-киназ 3 и 6 в фибробластоподобных синовиоцитах. J Immunol 174: 4301–4306.
  21. 21. Йошизава Т., Хаммейкер Д., Бойл Д.Л., Корр М., Флавелл Р. и др. (2009) Роль MAPK-киназы 6 при артрите: отдельный механизм действия при воспалении и экспрессии цитокинов.J Immunol 183: 1360–1367.
  22. 22. Хаммейкер Д., Тополевски К., Эдгар М., Йошизава Т., Фукусима А. и др. (2012) Снижение тяжести индуцированного коллагеном артрита и адаптивного иммунитета у мышей с дефицитом MKK-6. Arthritis Rheum 64: 678–687.
  23. 23. Иноуэ Т., Бойл Д.Л., Корр М., Хаммейкер Д., Дэвис Р.Дж. и др. (2006) Митоген-активируемая протеинкиназа-киназа 3 является основным путем, регулирующим активацию p38 при воспалительном артрите. Proc Natl Acad Sci U S A 103: 5484–5489.
  24. 24. Boyle DL, Rosengren S, Bugbee W, Kavanaugh A, Firestein GS (2003) Количественный анализ биомаркеров экспрессии синовиального гена с помощью ПЦР в реальном времени. Arthritis Res Ther 5: R352–360.
  25. 25. Matsumoto M, Sudo T, Saito T, Osada H, Tsujimoto M (2000) Участие сигнального пути митоген-активируемой протеинкиназы p38 в остеокластогенезе, опосредованном активатором рецептора лиганда NF-каппа B (RANKL). J Biol Chem 275: 31155–31161.
  26. 26. Mbalaviele G, Anderson G, Jones A, De Ciechi P, Settle S и др.(2006) Ингибирование митоген-активируемой протеинкиназы p38 предотвращает воспалительную деструкцию кости. J Pharmacol Exp Ther 317: 1044–1053.
  27. 27. Matsumoto M, Sudo T, Maruyama M, Osada H, Tsujimoto M (2000) Активация митоген-активируемой протеинкиназы p38 имеет решающее значение в остеокластогенезе, индуцированном фактором некроза опухоли. Febs Lett 486: 23–28.
  28. 28. Хуанг Х., Чанг Э.Д., Рю Дж., Ли Ч., Ли Й и др. (2006) Индукция c-Fos и NFATc1 во время дифференцировки остеокластов, стимулированной RANKL, опосредуется сигнальным путем p38.Biochem Biophys Res. Commun. 351: 99–105.
  29. 29. So H, Rho J, Jeong D, Park R, Fisher DE и др. (2003) Фактор транскрипции микрофтальмии и PU.1 синергетически индуцируют экспрессию гена рецептора, ассоциированного с остеокластами, рецептором лейкоцитов. J Biol Chem 278: 24209–24216.
  30. 30. Сундарам К., Нисимура Р., Сенн Дж., Юсеф Р.Ф., Лондон С.Д. и др. (2007) Передача сигналов лиганда RANK модулирует экспрессию гена матриксной металлопротеиназы-9 во время дифференцировки остеокластов.Exp Cell Res 313: 168–178.
  31. 31. Ямасита Т., Кобаяси Ю., Мидзогути Т., Ямаки М., Миура Т. и др. (2008) MKK6-p38 MAPK сигнальный путь увеличивает выживаемость, но не способствует резорбции костной ткани остеокластами. Biochem Biophys Res Commun 365: 252–257.
  32. 32. Хуанг Х., Рю Дж., Ха Дж., Чанг Э. Дж., Ким Х. Дж. И др. (2006) Дифференцировка остеокластов требует TAK1 и MKK6 для индукции NFATc1 и трансактивации NF-kappaB с помощью RANKL. Разница в клеточной смерти 13: 1879–1891.
  33. 33.Khosla S, Oursler MJ, Monroe DG (2012) Эстроген и скелет. Тенденции метаболизма эндокринола 23: 576–581.
  34. 34. Армас Л.А., Реккер Р.Р. (2012) Патофизиология остеопороза: новые механистические взгляды. Endocrinol Metab Clin North Am 41: 475–486.
  35. 35. Сибата Т., Шира-Иши А., Сато Т., Масаки Т., Масуда А. и др. (2002) Гормон витамина D ингибирует остеокластогенез in vivo, уменьшая пул предшественников остеокластов в костном мозге. J Bone Miner Res 17: 622–629.
  36. 36. Болон Б., Картер С., Дарис М., Морони С., Каппарелли С. и др. (2001) Аденовирусная доставка остеопротегерина улучшает резорбцию кости в модели остеопороза у мышей с овариэктомией. Мол Тер 3: 197–205.
  37. 37. Крам С.А., Браун М. (2008) Раскрытие действия эстрогенов при остеопорозе. Клеточный цикл 7: 1348–1352.
  38. 38. Крам С.А., Миранда-Карбони Г.А., Хаушка П.В., Кэрролл Дж. С., Лейн Т.Ф. и др. (2008) Эстроген защищает кость, индуцируя лиганд Fas в остеобластах для регулирования выживания остеокластов.EMBO J 27: 535–545.
  39. 39. Накамура Т., Имаи Ю., Мацумото Т., Сато С., Такеучи К. и др. (2007) Эстроген предотвращает потерю костной массы за счет альфа-рецептора эстрогена и индукции лиганда Fas в остеокластах. Ячейка 130: 811–823.
  40. 40. Passeri G, Girasole G, Jilka RL, Manolagas SC (1993) Увеличение выработки интерлейкина-6 костным мозгом и костными клетками мышей после отмены эстрогена. Эндокринология 133: 822–828.
  41. 41. Srivastava S, Weitzmann MN, Kimble RB, Rizzo M, Zahner M и др.(1998) Эстроген блокирует экспрессию гена M-CSF и образование остеокластов, регулируя фосфорилирование Egr-1 и его взаимодействие с Sp-1. J Clin Invest 102: 1850–1859.
  42. 42. Тьяги AM, Шривастава К., Мансури М.Н., Триведи Р., Чаттопадхьяй Н. и др. (2012) Дефицит эстрогена вызывает дифференцировку клеток Th27, секретирующих IL-17: новый кандидат в патогенезе остеопороза. PLoS One 7: e44552.
  43. 43. Токуда Х., Канно Й., Исисаки А., Такенака М., Харада А. и др.(2004) Интерлейкин (ИЛ) -17 усиливает стимулированный фактором некроза опухоли альфа синтез ИЛ-6 через митоген-активируемую протеинкиназу р38 в остеобластах. J Cell Biochem 91: 1053–1061.
  44. 44. Гринблатт МБ, Шим Дж. Х., Зоу В., Ситара Д., Швейцер М. и др. (2010) Путь p38 MAPK важен для скелетогенеза и гомеостаза костей у мышей. Дж. Клин Инвест 120: 2457–2473.

Сигнальный каскад Mkk3 / 6-p38 изменяет внутриклеточное распределение Hnrnp A1 и модулирует альтернативную регуляцию сплайсинга | Журнал клеточной биологии

Отдельные члены семейств белков серин-аргинин (SR) и гетерогенный ядерный рибонуклеопротеин (hnRNP) A / B обладают антагонистическими эффектами в регулировании альтернативного сплайсинга.Хотя hnRNP A1 накапливается преимущественно в ядре, она постоянно перемещается между ядром и цитоплазмой. Некоторые, но не все белки SR также подвергаются ядерно-цитоплазматическому перемещению, на которое влияет фосфорилирование их богатого серином / аргинином (RS) домена. Сигнальные механизмы, которые контролируют субклеточную локализацию этих белков, неизвестны. Мы показываем, что воздействие на клетки почек зеленой мартышки (COS), трансформированные NIH-3T3 и SV-40, стрессовым стимулам, таким как осмотический шок или УФ-излучение, но не митогенным активаторам, таким как PDGF или EGF, приводит к заметному цитоплазматическому накоплению hnRNP. A1, сопровождающееся повышением его фосфорилирования.Эти эффекты опосредуются путем MKK 3/6 -p38, и, кроме того, активация p38 необходима и достаточна для индукции накопления в цитоплазме hnRNP A1. Стресс-индуцированное повышение цитоплазматических уровней белков hnRNP A / B и сопутствующее снижение их ядерной численности происходит параллельно с изменениями в альтернативном паттерне сплайсинга репортера сплайсинга пре-мРНК аденовируса E1A. Эти результаты предполагают интригующую возможность того, что сигнальные механизмы регулируют сплайсинг пре-мРНК in vivo, влияя на субклеточное распределение факторов сплайсинга.

Гетерогенный ядерный рибонуклеопротеин A1 (hnRNP) является обильным ядерным РНК-связывающим белком, участвующим в процессинге пре-мРНК (Dreyfuss et al. 1993). hnRNP A1 связывается с большинством транскриптов РНК-полимеразы II, проявляя высокое сродство к последовательностям, которые напоминают сайты сплайсинга (Burd and Dreyfuss, 1994), и может регулировать альтернативный сплайсинг in vitro и in vivo путем антагонизма белков семейства серин-аргинин (SR) ( Майеда и Крайнер 1992; Касерес и др.1994; Ян и др. 1994; рассмотрено в Cáceres and Krainer, 1997).

Хотя hnRNP A1 локализуется преимущественно в ядре, он постоянно перемещается между ядром и цитоплазмой, и обработка ингибитором транскрипции актиномицином D приводит к его цитоплазматическому накоплению (Piñol-Roma and Dreyfuss 1992). Подмножество белков SR человека также быстро и непрерывно перемещается между ядром и цитоплазмой (Cáceres et al.1998). Способность hnRNP и SR белков к челночному движению может быть существенной для дополнительных ролей, которые эти белки играют в ядерном экспорте зрелых мРНК (Izaurralde et al. 1997), трансляции и / или посттрансляционных событиях. Напр., HnRNP A1 может сделать трансляцию зависимой от кэпа in vitro, что предполагает роль hnRNP A1 в регуляции трансляции белка (Svitkin et al. 1996). Другие белки-челноки, такие как hnRNP K и hnRNP E1, регулируют трансляцию 15-липоксигеназы путем связывания со специфическими последовательностями в 3'-нетранслируемой области мРНК (Ostareck et al.1997).

Временная сверхэкспрессия киназы Clk / Sty влияет на субклеточное распределение белка SR SF2 / ASF, вызывая его цитоплазматическое накопление (Cáceres et al. 1998). Этот эффект, скорее всего, связан с фосфорилированием RS-домена SF2 / ASF. Однако неясно, вызваны ли эти изменения клеточной локализации активацией ядерного экспорта или ингибированием ядерного импорта SF2 / ASF. Это наблюдение предполагает, что механизмы передачи сигналов, которые контролируют субклеточное распределение регуляторов сплайсинга, могут влиять на регуляцию сплайсинга, изменяя соотношение антагонистических факторов в ядре.В самом деле, временная трансфекция киназы Clk / Sty влияет на паттерн сплайсинга транскриптов котрансфицированного репортера сплайсинга E1A (Duncan et al. 1997).

Сигнальные пути, которые связывают мембранные события с цитоплазматическими / ядерными эффектами, недавно были сгруппированы в киназные каскады, активируемые либо митогенными, либо стрессовыми стимулами (Davis 1993, Davis 1994). Митогенные сигналы сходятся в модуль киназы MEK / MAP, тогда как сигналы стресса приводят к активации двух каскадов киназ, которые подобны митогенной киназе MAP (также известной как ERK; Canman and Kastan 1996).Осмотический шок, воспалительные цитокины, а также УФС-излучение и церамид стимулируют эти два каскада киназ стресс-реакции, которые включают активацию SAPK (также известного как JNK) с помощью SEK-1 и киназы p38 с помощью MKK 3 / 6 (Кириакис и Авруч 1996, Карин 1998). Хотя события перед SEK-1 и MKK 3/6 все еще плохо определены, активация SAPK и / или p38 является критическим этапом в контроле реакции на стресс. Все три киназы MAP достигают высшей точки в фосфорилировании и активации важных факторов транскрипции, таких как elk-1, c-Jun или ATF-2 (Davis 1993, Davis 1994; Kyriakis and Avruch 1996).Однако для этих киназ существуют другие субстраты, такие как cPLA2 и p90 rsk (также известная как киназа MAPKAP-1) в случае киназы ERK или киназа MAPKAP-2 в случае p38 (Davis 1994; Kyriakis and Avruch 1996).

Сигнальные механизмы, управляющие перемещением hnRNP A1, если таковые имеются, неизвестны. Существование связи между этими сигнальными путями и перемещением hnRNP A1 д. Прояснить механизм, посредством которого пути сигнальной трансдукции регулируют не только транскрипцию генов, но также и правильный процессинг мРНК.Мы демонстрируем здесь, что субклеточная локализация hnRNP A1 может модулироваться путем MKK 3/6 -p38 в ответ на стресс, но не на митогенную стимуляцию. Вызванное стрессом повышение цитоплазматических уровней hnRNP A1 и сопутствующее снижение численности ядерных hnRNP A1 отражаются в изменениях активности альтернативного сплайсинга.

Мы предполагаем, что субклеточное распределение факторов сплайсинга является регулируемым процессом, который в случае hnRNP A1, по-видимому, является ранней реакцией на стресс с участием каскада киназ p38.

клеток NIH 3T3 и обогащенных аргинином / серином (RS) SV-40 трансформированных клеток почки зеленой мартышки (COS) культивировали в DME с добавлением 10% FCS. Клетки обрабатывали различными агонистами, как описано в подписях к фигурам. Сорбитол и актиномицин D были приобретены у Sigma Chemicals. Трансфекцию проводили кальций-фосфатным методом. Вкратце, субконфлюэнтные культуры клеток COS, выращенные на покровных стеклах в чашках диаметром 60 мм, трансфицировали 5 мкг плазмид, экспрессирующих MAPK, SAPK, p38, MKK 3/6 или их соответствующие мутанты.Плазмидную ДНК удаляли через 12 часов и добавляли DME, содержащий 10% FCS. Через 24 ч после трансфекции клетки либо оставляли необработанными, либо подвергали воздействию различных стимулов и фиксировали для непрямого иммунофлуоресцентного анализа.

Клетки фиксировали 4% p -формальдегидом в PBS в течение 15–30 мин при комнатной температуре с последующей инкубацией в течение 10 мин в 0,2% Triton X-100. Эндогенные hnRNP A1, hnRNP U и hnRNP C1 / C2 были визуализированы с помощью разведения 1: 1000 моноклональных антител 4B10, 3G6 или 4F4, соответственно, которые были любезно предоставлены Dr.Гидеон Дрейфус (Дрейфус и др. 1984; Пиньол-Рома и др. 1988). Эндогенный hnRNP B1 был визуализирован с использованием разведения 1: 1000 моноклонального антитела 2B2 (Kamma et al. 1999). Для локализации эндогенного белка SF2 / ASF использовали моноклональные антитела против SF2 / ASF (mAb 103) в разведении 1: 500 (Cáceres et al. 1997). Для локализации эндогенного белка SC35 в качестве асцита использовали моноклональное антитело против SC35 в разведении 1: 1000 (Fu and Maniatis 1990). Затем клетки трижды промывали PBS и инкубировали при комнатной температуре с разведением 1: 200 козьих антимышиных IgG, конъюгированных с флуоресцеином (Jackson ImmunoResearch Laboratories).После трехкратной промывки покровные стекла переворачивали и помещали на предметные стекла микроскопа. Двойной иммунофлуоресцентный анализ эндогенных hnRNP A1 и HA- или myc-меченых белков проводили с использованием моноклональных анти-hnRNP A1 4B10 и кроличьих поликлональных анти-HA или анти-myc антител (Santa Cruz Biotechnology, Inc.) с последующим использованием смеси конъюгированные с флуоресцеином антимышиные и конъюгированные родамином антикроличьи антитела (Jackson ImmunoResearch Laboratories). Образцы наблюдали на микроскопе Zeiss Axioskop, а изображения получали с помощью охлаждаемой CCD-камеры Photometrics Ch350 с использованием расширений Digital Scientific Smartcapture в программном обеспечении IP Lab Spectrum.

Метаболически 32 Р-меченные клетки NIH-3T3 либо оставляли необработанными, либо подвергали воздействию среды с высокой осмолярностью (OSM) в течение разного времени. Впоследствии лизаты клеток получали с буфером RIPA, содержащим 10 мкг / мл лейпептина и апротинина, 1 мМ фенилметилсульфонилфторид, 0,25 мМ ортованадат, 20 мМ β-глицерофосфат и 10 мМ фторид натрия. Эндогенный hnRNP A1 иммунопреципитировали моноклональным антителом 4B10, и уровень его фосфорилирования определяли авторадиографией после SDS-PAGE.

Для вестерн-блоттинга лизаты клеток готовили с буфером RIPA, как описано выше. Электрофоретически разделенные белки переносили на мембраны Hybond P (Amersham Pharmacia Biotech). Неспецифическое связывание блокировали путем инкубации блота с 5% обезжиренным сухим молоком в TBST (20 мМ Трис, pH 7,6, 137 мМ NaCl и 0,1% Твин 20). Белки определяли последующей инкубацией с первичным антителом в TBST.Были использованы следующие первичные антитела: кроличьи поликлональные антитела против фосфо-p38-киназы в разведении 1: 1000 (9211; New England Biolabs), кроличьи поликлональные антитела против фосфо-SAPK в разведении 1: 1000 (9251; New England Biolabs) ), кроличьи поликлональные антитела против cdc2 (PSTAIRE) в разведении 1: 500 (sc-53; Santa Cruz Biotechnology, Inc.) и мышиные моноклональные антитела против hnRNP A1 4B10 в разведении 1: 1000. После тщательной промывки TBST блоты инкубировали со вторичными антителами (либо козьими антителами против кроличьего IgG, либо козьими антителами против мышиного IgG; sc-2004 или 2005, соответственно; Santa Cruz Biotechnology, Inc.), конъюгированный с пероксидазой хрена в разведении 1: 7000. После дальнейшего промывания в TBST блоты проявляли с использованием ECL.

Воздействие на клетки NIH-3T3 осмотического шока (OSM; DME + 400 мМ сорбитола) индуцировало детектируемое накопление hnRNP A1 в цитоплазме в течение 30 минут после стимуляции клеток, и этот ответ достиг пика через 2 часа (рис. 1 A). Этот эффект был обратимым, и к 5 часам осмотического шока белок hnRNP A1 стал ядерным в большинстве клеток (рис.1 А, верхняя панель; Стол). Принимая во внимание, что ~ 65–80% клеток NIH-3T3 обратимо накапливали hnRNP A1 в цитоплазме при воздействии 400 мМ сорбита; (Рис. 1 A и таблица), ~ 100% клеток демонстрировали необратимое цитоплазматическое накопление hnRNP A1, когда концентрация сорбита была увеличена до 600 мМ (рис. 1 A, средняя панель). В качестве контроля окрашивание нешаттнирующего белка hnRNP U подходящим антителом (Dreyfuss et al.1984) продемонстрировало, что этот эффект был специфическим и не связан с генерализованной утечкой ядер, поскольку не наблюдалось накопления белка hnRNP U в цитоплазме (рис. .1 Б).

При облучении клеток УФ-С светом hnRNP A1 накапливалась в цитоплазме, но с более медленной кинетикой, чем наблюдаемая после осмотического стресса. В клетках, облученных УФ-С, накопление цитоплазмы hnRNP A1 было обнаружено через 2 часа и было максимальным через 5 часов (рис. 1 A, нижняя панель). УФ-С свет заставляет клетки претерпевать апоптоз; однако цитоплазматическое накопление hnRNP A1 не зависело от этого процесса, поскольку 5-часовая временная точка была получена в присутствии мощного ингибитора каспазы (Z-VAD).Как наблюдалось с OSM, УФ-C-облучение не вызывало изменений в субклеточном распределении hnRNP U (рис. 1B).

В отличие от эффектов OSM и УФ-света, стимуляция покоящихся клеток 3T3, лишенных сыворотки, различными факторами роста, такими как PDGF или EGF, не изменяла клеточного распределения hnRNP A1 (не показано). Примечательно, что предварительная обработка клеток NIH-3T3 100 мкМ циклогексимида для блокирования синтеза белка за 4 часа до стимула не влияла на способность различных стрессовых стимулов способствовать накоплению в цитоплазме hnRNP A1 (не показано).Это наблюдение демонстрирует, что накопление hnRNP A1 в цитоплазме не представляет собой вновь синтезированный белок в сочетании с блокировкой ядерного импорта.

Чтобы проверить, является ли цитоплазматическое накопление hnRNP A1 в ответ на стресс клеточно-специфическим, мы подвергли различные клеточные линии OSM и / или УФ-C облучению и проанализировали субклеточное распределение группы белков hnRNP и SR.Воздействие OSM (DME + 400 мМ сорбита) на клетки COS в течение 2 ч индуцировало цитоплазматическое накопление hnRNP A1 в 35–45% клеток (рис. 2 и таблица). Никаких заметных изменений в субклеточном распределении нешаттинговых белков hnRNP U и hnRNP C не наблюдалось. Кинетика цитоплазматического накопления hnRNP A1 различалась между клетками NIH-3T3 и COS, поскольку в последних hnRNP A1 оставалась цитоплазматической после 5-часовой инкубации, а возврат к паттерну ядерной локализации наблюдался только после 10-часовой инкубации (данные не показано).Ответ белков SR на OSM в клетках COS варьировал. В случае SF2 / ASF только небольшая часть клеток накапливала эндогенный SF2 / ASF в цитоплазме (5%), что аналогично тому, что наблюдалось в клетках 3T3 (см. Таблицу). Напротив, SC35 оставался ядерным (рис. 2). В соответствии с тем, что наблюдалось в клетках 3T3, УФ-C-облучение клеток COS индуцировало цитоплазматическое накопление hnRNP A1 в небольшом количестве клеток (3–6% по сравнению с 15–20% в клетках 3T3, таблица), тогда как SF2 / ASF остались ядерными (таблица).Аналогичные результаты были получены с двумя линиями клеток человека, HeLa и 293 (данные не показаны).

Мы проанализировали распределение другого челночного белка hnRNP, hnRNP B1, который по последовательности тесно связан с hnRNP A1, а также противодействует белкам SR в регуляции сплайсинга (Biamonti et al. 1994; Mayeda et al. 1994). Интересно, что мы обнаружили, что 400 мМ сорбита существенно не изменяли ядерную локализацию hnRNP B1 в клетках COS, в отличие от того, что наблюдалось для hnRNP A1 (таблица).С другой стороны, 600 мМ сорбитол индуцировал цитоплазматическое накопление hnRNP B1 в ~ 100% клеток, аналогично тому, что наблюдалось для hnRNP A1. Воздействие УФ-С света приводило к цитоплазматической релокализации hnRNP B1 в 10–15% клеток (таблица). Эти эксперименты убедительно свидетельствуют о том, что вызванное стрессом цитоплазматическое накопление белков hnRNP и SR не является общей характеристикой челночных белков по сравнению с не перемещающимися белками, а скорее уникальным ответом отдельных белков на передачу сигналов стресса (рис.1 и рис.2 и таблица). Сводная информация о локализации различных белков hnRNP и SR в клетках, обработанных OSM и УФ, представлена ​​в таблице.

Эта серия экспериментов демонстрирует, что изменения в субклеточном распределении hnRNP A1 после передачи сигналов стресса не являются явлением, специфичным для определенного типа клеток. Тот факт, что hnRNP U (Fig. 1 B), hnRNP C и SC35 (Fig. 2) оставались исключительно ядерными в клетках, подвергшихся воздействию различных стрессовых стимулов, также указывает на то, что обработка OSM и УФ не влияет на общую целостность клетки или морфологию ядерной оболочки.Кроме того, эти меры контроля демонстрируют, что общий импорт и экспорт клеточного белка не нарушается после передачи сигналов стресса.

Мы не обнаружили фосфорилирования hnRNP A1 активированной киназой p38 in vitro (не показано). Однако фосфорилирование hnRNP A1 резко возрастает после воздействия OSM на клетки NIH-3T3. Динамика фосфорилирования hnRNP A1 при 600 мМ сорбите хорошо коррелировала с кинетикой его цитоплазматического накопления (рис.3 В). Фосфорилирование hnRNP A1 постепенно увеличивалось с течением времени, и в этих экспериментальных условиях ~ 100% клеток накапливали hnRNP A1 в цитоплазме необратимым образом (рис. 1 A и таблица). Когда клетки NIH-3T3 подвергались воздействию 400 мМ сорбита, hnRNP A1 также становился фосфорилированным, хотя и в гораздо меньшей степени. Фосфорилирование HnRNP A1 достигает плато через 2–5 часов после стимуляции, однако возврат к ядерной локализации наблюдается через 5 часов, когда hnRNP A1 все еще фосфорилирован.Неспособность hnRNP A1 вернуться в ядро ​​после воздействия 600 мМ сорбита может быть следствием гиперфосфорилированного состояния белка в этих условиях. Мы также наблюдали сопоставимый паттерн фосфорилирования hnRNP A1 в клетках COS, подвергнутых воздействию OSM (не показано). В совокупности эти результаты показывают, что, хотя hnRNP A1 не может быть прямым субстратом киназы p38 in vitro, она фосфорилируется в ответ на стресс, и кинетика фосфорилирования и накопления в цитоплазме схожи.

Сигнальные пути, активируемые стрессом, были тщательно изучены (Canman and Kastan 1996; Hannun 1996; Kyriakis and Avruch 1996; Karin 1998). Различные стрессовые стимулы, такие как осмотический шок, УФ-облучение и церамид, активируют два каскада киназ стресс-реакции, которые являются критическими этапами в контроле стрессовой реакции: SAPK (также известный как JNK) с помощью SEK-1 и киназа p38 по MKK 3/6 (Канман и Кастан 1996; Кириакис и Авруч 1996, Карин 1998).Поэтому мы проанализировали потенциальную роль киназных путей SAPK и p38 в контроле субклеточного перераспределения hnRNP A1 после передачи сигналов стресса. Клетки COS трансфицировали экспрессирующими плазмидами, кодирующими HA-меченые версии дикого типа или доминантно-отрицательных мутантов киназы MAPK / ERK, SAPK или p38 (Berra et al. 1995; Raingeaud et al. 1996). Трансфицированные клетки подвергали воздействию OSM, и субклеточную локализацию эндогенного hnRNP A1 определяли с помощью двойного иммунофлуоресцентного окрашивания (рис.4 а). Экспрессия доминантно-отрицательного мутанта p38 отменяла эффект OSM, блокируя накопление hnRNP A1 в цитоплазме (рис. 4, a и b), тогда как экспрессия p38 дикого типа не влияла (рис. 4 b). . Экспрессия доминантно-отрицательной ERK или SAPK (фиг. 4, a и b) и ERK или SAPK дикого типа также не имела эффекта (фиг. 4 b). Таким образом, блокирования пути p38 с помощью доминантно-отрицательной формы киназы p38 достаточно для предотвращения накопления в цитоплазме hnRNP A1 после OSM, что убедительно свидетельствует о том, что этот сигнальный путь ответственен за его измененное субклеточное распределение.

hnRNP A1 непосредственно фосфорилируется in vitro протеинкиназой A (PKA) и ζ PKC (Cobianchi et al. 1993; Municio et al. 1995). Хотя экспрессия конститутивно активного мутанта ζ PKC способствует накоплению в цитоплазме hnRNP A1 в пролиферирующих клетках NIH-3T3 (Municio et al., 1995), трансфекция неактивного киназы доминантно-отрицательного мутанта ζ PKC не имела влияние на накопление в цитоплазме hnRNP A1 в ответ на OSM (рис.4 б). Следовательно, ζ PKC, по-видимому, не играет роли в регуляции перемещения hnRNP A1 в ответ на стресс.

Нуклео-цитоплазматические свойства перемещения hnRNP A1 были первоначально обнаружены при воздействии на клетки актиномицина D (Piñol-Roma and Dreyfuss 1992). Эти эксперименты показали, что накопление hnRNP A1 в цитоплазме является прямым следствием ингибирования транскрипции РНК-полимеразы II.Эксперимент на рис. 4c ясно демонстрирует, что трансфекция доминантно-отрицательной формы киназы p38 не влияет на способность актиномицина D способствовать накоплению в цитоплазме hnRNP A1, что указывает на то, что действие актиномицина D на перемещение hnRNP A1 действительно не вовлекает путь p38. Более того, стрессовые сигналы не вызывают общего ингибирования транскрипции; напротив, транскрипция нескольких генов, таких как ген альдозоредуктазы, активируется как клеточный ответ на гиперосмолярность (Ferraris et al.1996; Ruepp et al. 1996). Кроме того, несколько нижестоящих мишеней обоих путей стресса, такие как hsp27, ATF-2 и c-jun, являются факторами транскрипции, которые после активации киназой SAPK и p38, в свою очередь, активируют транскрипцию нижестоящих генов. Мы пришли к выводу, что накопление в цитоплазме hnRNP A1 в ответ на стресс не связано с общим ингибированием транскрипции.

Хотя OSM и УФ индуцируют цитоплазматическое накопление hnRNP A1, эти стимулы могут запускать различные пути.Мы проанализировали активацию как киназы p38, так и SAPK в клетках, подвергшихся воздействию различных стрессовых стимулов, с помощью вестерн-блоттинга, используя специфические антитела, которые распознают фосфорилированную, то есть активированную форму этих протеинкиназ. Мы сравнили активацию киназы p38 и SAPK в клетках, подвергнутых воздействию 400 мМ сорбита, 600 мМ сорбита или УФ-С. В соответствии с предыдущими результатами (рассмотренными в Canman and Kastan 1996; Kyriakis and Avruch 1996, Karin 1998) мы обнаружили, что и киназа p38, и SAPK активируются под действием OSM и УФ-C облучения, что видно по появлению их соответствующих фосфорилированных форм. после различных стрессовых стимулов (рис.5). Однако максимальная активация киназы p38 была получена при использовании 600 мМ сорбита, который также оказывает сильнейший эффект релокализации на hnRNP A1. В то же время 600 мМ сорбитола также вызывает самую высокую активацию SAPK. Однако тот факт, что доминантно-отрицательная форма киназы p38, но не доминантно-отрицательная форма SAPK, блокирует цитоплазматическое накопление hnRNP A1, индуцированное OSM, ясно демонстрирует, что наблюдаемый эффект проявляется через путь киназы p38 (рис. . 4). Однако остается возможным, что накопление в цитоплазме hnRNP A1, индуцированное УФ-С, может вовлекать путь SAPK.

В совокупности приведенные выше результаты предполагают, что накопление в цитоплазме hnRNP A1, вызванное клеточным стрессом, требует функциональной киназы p38. Чтобы проверить, является ли активация p38 не только необходимой, но и достаточной ли для стимулирования цитоплазматического накопления hnRNP A1, клетки COS трансфицировали myc-меченной версией конститутивно активного мутанта MKK 3/6 (MKK 3/6 DD , Cuenda et al.1996) либо отдельно, либо в комбинации с плазмидами, кодирующими HA-меченые версии дикого типа или доминантно-отрицательных мутантов киназы p38. Впоследствии локализацию эндогенного hnRNP A1 в отсутствие любого другого стимула определяли с помощью иммунофлуоресценции с двойной меткой. Условия трансфекции были оптимизированы для достижения одновременной экспрессии киназ, меченных эпитопом myc и HA, в 75–85% трансфицированных клеток по данным иммунофлуоресцентной микроскопии (не показано). Экспрессия конститутивно активного мутанта MKK 3/6 DD была недостаточна для индукции накопления в цитоплазме эндогенного hnRNP A1.Однако котрансфекция MKK 3/6 DD с p38 дикого типа привела к цитоплазматическому накоплению эндогенного hnRNP A1 в> 80% клеток, которые экспрессировали меченый MKK 3/6 DD (рис. , а и б). Это цитоплазматическое накопление не наблюдалось, когда MKK 3/6 DD котрансфицировали доминантно-отрицательным мутантом киназы p38. Кроме того, версия MKK 3/6 дикого типа в комбинации с киназой p38 дикого типа индуцировала цитоплазматическую hnRNP A1 в <15% трансфицированных клеток, а hnRNP A1 не наблюдалась в цитоплазме клеток, трансфицированных версия дикого типа MKK 3/6 отдельно (рис.6 б). Более того, этот эффект был специфическим для hnRNP A1, поскольку не наблюдали изменений в субклеточном распределении ни hnRNP U, ни hnRNP C (не показано). Из-за технической сложности одновременного обнаружения эндогенных hnRNP A1 вместе с обеими котрансфицированными киназами (MKK 3/6 , меченный myc и p38, меченный HA), мы также проанализировали локализацию эндогенного hnRNP A1 и p38, меченного HA в параллельные эксперименты. Были получены практически идентичные результаты (не показаны), подтверждающие, что обе меченые киназные конструкции экспрессируются в одних и тех же клетках.

Из этих экспериментов мы пришли к выводу, что активация пути MKK 3/6 -p38 необходима и достаточна для индукции цитоплазматического накопления hnRNP A1 в ответ на клеточный стресс.

Альтернативный сплайсинг - широко распространенный механизм пространственного или временного контроля экспрессии генов. hnRNP A1 и другие близкородственные белки hnRNP A / B обладают зависимым от концентрации эффектом на выбор альтернативных 5'-сайтов сплайсинга как in vitro, так и in vivo (Mayeda and Krainer 1992; Cáceres et al.1994; Ян и др. 1994). Количество hnRNP A1 относительно количества фактора сплайсинга SF2 / ASF определяет использование альтернативных 5'-сайтов сплайсинга, так что, когда hnRNP A1 в избытке, обычно выбираются дистальные 5'-сайты сплайсинга, а когда SF2 / ASF находится в предпочтение отдается избытку проксимальных 5'-сайтов сплайсинга (Mayeda and Krainer 1992; Cáceres et al. 1994; Yang et al. 1994). Поскольку цитоплазматические уровни SF2 / ASF не увеличивались заметно в стресс-активированных клетках (рис.2 и таблица), мы пришли к выводу, что вызванное стрессом повышение цитоплазматических уровней hnRNP A1 и сопутствующее снижение численности ядер hnRNP A1 должно быть благоприятствуют выбору проксимальных 5'-сайтов сплайсинга.Чтобы проверить эту гипотезу, клетки COS трансфицировали репортерным геном аденовируса E1A и клетки либо оставляли необработанными, либо подвергали воздействию OSM (DME + 600 мМ сорбитола) в течение 4 часов. В клетках, подвергнутых воздействию 0,6 М сорбита, использование самого дистального 5'-сайта сплайсинга (которое дает изоформу 9S) воспроизводимо ингибировалось (как показано снижением 9S с 45% в контроле до 24% после OSM). ; Рис.7). Аналогичные результаты были получены в клетках 3T3 (данные не показаны).

Мы показали, что котрансфекция MKK 3/6 DD и р38 дикого типа вызывает биологический ответ, т.е.е., накопление в цитоплазме hnRNP A1 в отсутствие восходящего сигнала (т.е. OSM, фиг. 6). Чтобы еще раз подтвердить, что наблюдаемое изменение в альтернативном паттерне сплайсинга репортера E1A после OSM было опосредовано активацией каскада киназ MKK 3/6 -p38, клетки COS трансфицировали плазмидами экспрессии, кодирующими myc-меченые версии MKK 3/6 киназа или ее постоянно активный мутант (MKK 3/6 DD ) в сочетании с HA-меченными версиями киназы p38 дикого типа или ее доминантно-отрицательным мутантом (p38 DN ).Действительно, использование наиболее удаленного альтернативного 5'-сайта сплайсинга E1A (изоформа 9S) воспроизводимо ингибировалось в клетках, котрансфицированных MKK 3/6 DD и p38 дикого типа, но не в клетках, трансфицированных одной киназой по отдельности ( Рис.7). Напротив, ингибирование дистального сайта сплайсинга не наблюдалось, когда репортер сплайсинга E1A котрансфицировали MKK 3/6 DD и p38 DN , или MKK 3/6 дикого типа отдельно или в комбинации с p38 дикого типа (рис.7). Экспрессия p38 дикого типа или MKK 3/6 DD в отдельности приводила к повышенному уровню транскрипта 9S, вероятно, из-за неспецифических событий. Таким образом, существует сильная корреляция между активацией каскада киназ MKK 3/6 -p38 (который индуцирует накопление в цитоплазме hnRNP A1) и ингибированием 9S дистального сайта сплайсинга E1A. Хотя снижение уровней 9S мРНК при уменьшении ядерной hnRNP A1 согласуется с известными зависимыми от концентрации эффектами hnRNP A1 на выбор альтернативного 5'-сайта сплайсинга, мы не можем исключить возможность того, что накопление hnRNP A1 в цитоплазме приводит к для дифференциальной стабилизации различных альтернативно соединенных изоформ.

В заключение, эти эксперименты убедительно свидетельствуют о том, что стрессовые стимулы запускают изменения в альтернативном сплайсинге клеточных генов, уменьшая ядерное соотношение hnRNP A1 к SF2 / ASF посредством модуляции нуклео-цитоплазматического транспорта hnRNP A1.

Мы впервые показываем здесь, что путь передачи сигнала может контролировать выбор альтернативного сайта сплайсинга in vivo, регулируя клеточную локализацию факторов сплайсинга пре-мРНК.Мы показали, что двунаправленный транспорт hnRNP A1 между ядром и цитоплазмой не является конститутивным процессом. Вместо этого он подвергается модуляции внеклеточными сигналами, которые запускают быстрые изменения в распределении белка между этими клеточными компартментами. Перемещение hnRNP A1 в цитоплазму в стресс-активированных клетках опосредовано путем MKK 3/6 -p38, активация которого необходима и достаточна для накопления в цитоплазме hnRNP A1.В то же время OSM приводит к фосфорилированию hnRNP A1 с кинетикой, параллельной локализации hnRNP A1. Хотя роль фосфорилирования белков в сплайсинге неясна, недавние наблюдения подтверждают, что фосфорилирование модулирует межбелковые взаимодействия внутри сплайсосомы и контролирует субядерное распределение белков SR в интерфазе и митозе (Misteli 1999). Кроме того, фосфорилирование регуляторов сплайсинга может быть способом регулирования субклеточного распределения антагонистических факторов, и возникающие в результате изменения соотношений этих факторов в ядре могут, в свою очередь, влиять на активность сплайсинга.Этот предложенный механизм представляет собой новый способ регулирования выбора альтернативных сайтов сплайсинга.

hnRNP A1 непосредственно фосфорилируется in vitro PKA, казеинкиназой II (CKII) и ζPKC (Cobianchi et al. 1993; Municio et al. 1995), но не является прямой мишенью киназы p38 (не показано). Фосфорилирование PKA значительно изменяет свойства hnRNP A1, подавляя его способность к отжигу цепи, не влияя на его способность связывать нуклеиновые кислоты (Cobianchi et al.1993). Мы показали, что стрессовые сигналы индуцируют накопление в цитоплазме hnRNP A1, что сопровождается увеличением его фосфорилирования. Хотя экспрессия постоянно активного мутанта ζPKC способствует накоплению в цитоплазме hnRNP A1 в пролиферирующих клетках (Municio et al., 1995), трансфекция киназно-неактивного доминантно-отрицательного мутанта ζPKC не влияла на накопление hnRNP A1 в цитоплазме. в ответ на стресс (не показано). Что касается потенциальной роли PKA в этом пути, воздействие на клетки дибутирил-цАМФ или холерного токсина, которые сильно активируют PKA in vivo, не индуцировало цитоплазматическое накопление hnRNP A1 (не показано).Следовательно, ни ζPKC, ни PKA киназы, по-видимому, не играют роли во время индуцированного стрессом субклеточного перераспределения hnRNP A1.

Механизм, посредством которого киназа p38 регулирует накопление в цитоплазме hnRNP A1, в настоящее время неизвестен. Большое увеличение фосфорилирования hnRNP A1 при осмотическом шоке может быть частью пути передачи сигнала, который приводит к его измененному разделению между ядром и цитоплазмой.Альтернативно, фосфорилирование hnRNP A1 может быть следствием его накопления и цитоплазмы, где он может подвергаться воздействию киназы, с которой он обычно не взаимодействует. Хотя hnRNP A1 не является прямым субстратом для p38, известно, что киназа p38 активирует другие киназы, такие как киназы MAPKAP-2 и -3 (McLaughlin et al. 1996), которые, в свою очередь, могут непосредственно фосфорилировать hnRNP A1, изменяя его челночные свойства. Киназа-2 MAPKAP и p38 образуют комплекс в ядре нестимулированных клеток, где киназа p38 неактивна.В стимулированных клетках фосфорилирование MAPKAP-киназы-2 с помощью p38 приводит к конформационному изменению в MAPKAP-киназе-2, что приводит к маскированию сигнала ядерной локализации (и, возможно, экспозиции сигнала ядерного экспорта), что вызывает релокализацию Комплекс p38-MAPKAP киназа-2 в цитоплазму. Таким образом, киназа-2 MAPKAP действует как эффектор p38 посредством фосфорилирования субстратов, так и как детерминант клеточной локализации p38 (Ben-Levy et al. 1998; Engel et al. 1998).Это событие цитоплазматической транслокации может позволить p38 и MAPKAP-киназе-2 фосфорилировать цитоплазматические мишени.

Альтернативно, влияние p38 на накопление в цитоплазме hnRNP A1 может быть непрямым, через модуляцию активности белков, участвующих в нуклео-цитоплазматическом транспорте hnRNP A1. В связи с этим был описан новый опосредованный рецепторами путь ядерного импорта, который отличается от классического опосредованного импортином пути NLS.Этот новый путь включает новый белок массой 90 кДа, транспортин, который физически взаимодействует с hnRNP A1 и служит для облегчения ядерного импорта hnRNP A1 (Pollard et al. 1996). Привлекательная возможность состоит в том, что каскад киназы p38 посредством фосфорилирования hnRNP A1 модулирует его взаимодействие с транспортином, что приводит к снижению скорости ядерного импорта. Однако неясно, является ли измененное внутриклеточное распределение hnRNP A1 после передачи сигналов стресса результатом ингибирования ядерного импорта или увеличения скорости ядерного экспорта.

Для большинства ядерных событий, регулируемых внеклеточными стимулами, мишенями сигнальных путей являются факторы транскрипции. Однако другие виды ядерной активности, такие как процессинг мРНК, также являются потенциальными мишенями для этих сигнальных путей. Одним из примеров регулируемого факторами роста события сплайсинга является процессинг пре-мРНК PTP-1B, который дает начало уникальной изоформе мРНК посредством альтернативного сплайсинга при стимуляции покоящихся клеток различными факторами роста (Shiffrin and Neel 1993). .Комплекс, связывающий ядерный кэп (CBC), также был идентифицирован как мишень для передачи сигнала, связанного с рецептором фактора роста (Wilson et al. 1999). Способность факторов роста стимулировать активность связывания кэпированной РНК коррелирует со стимуляцией факторами роста активности сплайсинга. CBC получает входные данные от нескольких путей, поскольку он активируется путем Ras-Raf-MEK, а также сигнальными путями, активируемыми стрессом. Однако на субклеточную локализацию обеих белковых субъединиц CBC (CBP80 и CBP20) стимуляция фактора роста не влияет (Wilson et al.1999).

Результаты, представленные здесь, устанавливают новую связь между сигнальными каскадами, которые являются центральными для контроля важных функций клетки, таких как реакция на стресс, и контроля экспрессии генов посредством обработки мРНК. Мы показали, что стрессовые сигналы индуцируют цитоплазматическое накопление hnRNP A1 одновременно с изменениями в альтернативном сплайсинге котрансфицированного репортера. Цитоплазматическое накопление hnRNP A1 после OSM предположительно вызывает изменение соотношения антагонистических альтернативных факторов сплайсинга SF2 / ASF и hnRNP A1 в ядре клетки.Действительно, альтернативный паттерн сплайсинга репортерного мини-гена E1A показывает снижение относительного уровня транскриптов 9S в клетках, подвергшихся воздействию стрессовых сигналов, по сравнению с необработанными клетками, что можно было бы ожидать для сплайсинга в присутствии пониженных уровней hnRNP A1. В дополнение к эффектам, присущим hnRNP A1, возможно, что другие факторы сплайсинга также изменяются осмотическим стрессом и активацией p38, внося свой вклад в общий эффект на альтернативный сплайсинг. Например, мы показали, что hnRNP B1 также накапливается в цитоплазме в этих условиях (таблица), и этот белок структурно и функционально тесно связан с hnRNP A1 (Mayeda et al.1994).

Настоящие находки демонстрируют, что изменения, опосредованные передачей сигналов, могут модулировать альтернативный сплайсинг, изменяя локализацию известных регуляторов сплайсинга. Этот регуляторный механизм может оказаться общим, с помощью которого различные сигнальные пути могут влиять на ядерное соотношение специфических антагонистических регуляторов сплайсинга, тем самым модулируя альтернативную регуляцию сплайсинга конкретных пре-мРНК.

активированных фосфорилатов человеческого ТАК1 MKK3 / MKK6

15837794 Одновременная блокада NFkappaB, JNK и p38 MAPK неактивным киназой мутантом протеинкиназы TAK1 повышает чувствительность клеток к апоптозу и влияет на определенный спектр [исправленных] генов-мишеней фактора некроза опухоли

Воры, А, Вольтер, С, Мушинский, Дж. Ф., Хоффманн, Э, Диттрих-Брейхольц, О, Грауэ, N, Дёрри, А, Шнайдер, H, Вирт, Д, Luckow, B, Реш, К, Крахт, М

J Biol Chem 2005
8622669 Экспрессия гена, регулируемая MKK3 и MKK6, опосредуется сигнальным путем передачи сигнала митоген-активируемой протеинкиназы p38.

Рейнго, Дж., Уитмарш, Эй Джей, Барретт, Т. Дериджард, Б, Дэвис, Р.Дж.

Mol Cell Biol 1996
8533096 Идентификация члена семейства MAPKKK как потенциального медиатора передачи сигнала TGF-бета

Ямагути, К., Ширакабе, К, Сибуя, H, Ири, К, Оиси, я, Уэно, Н, Танигучи, Т, Нисида, Э, Мацумото, К.

Наука 1995
16186825 Важная функция киназы TAK1 в врожденных и адаптивных иммунных ответах

Сато, S, Санджо, H, Такеда, К., Ниномия-Цудзи, Дж., Ямамото, М., Каваи, Т, Мацумото, К., Такеучи, О, Акира, S

Нат Иммунол 2005

 ---
кол-во: 71138
Страница 1
запрос: мкк-4
полученные результаты:
  -
    описание: ~
    этикетка: МКК-4
    имя:
      класс: белок
      выделять:
        метка:
          -  MKK  -  4 
      id: CE10328
      этикетка: МКК-4
      other_names: ~
      таксономия: c_elegans
    page_type: белок
    разновидность:
      ключ: c_elegans
      название: Caenorhabditis elegans
    таксономия:
      род: Caenorhabditis
      id: c_elegans
      виды: elegans
    wbid: CE10328
  -
    аллель:
      -
        класс: вариация
        id: WBVar00092756
        этикетка: ok1545
      -
        класс: вариация
        id: WBVar01178235
        этикетка: gk911432
      -
        класс: вариация
        id: WBVar01178234
        этикетка: gk512938
      -
        класс: вариация
        id: WBVar01178232
        этикетка: gk591978
      -
        класс: вариация
        id: WBVar00514241
        этикетка: gk290998
      -
        класс: вариация
        id: WBVar01178233
        этикетка: gk321621
      -
        класс: вариация
        id: WBVar01178229
        этикетка: gk880042
      -
        класс: вариация
        id: WBVar01498960
        этикетка: gk962707
      -
        класс: вариация
        id: WBVar01178239
        этикетка: gk648878
      -
        класс: вариация
        id: WBVar01500067
        этикетка: gk964260
      -
        класс: вариация
        id: WBVar00514240
        этикетка: gk290997
      -
        класс: вариация
        id: WBVar00514242
        этикетка: gk290999
      -
        класс: вариация
        id: WBVar01178236
        этикетка: gk466362
      -
        класс: вариация
        id: WBVar01178238
        этикетка: gk367344
      -
        класс: вариация
        id: WBVar01178237
        этикетка: gk849728
      -
        класс: вариация
        id: WBVar01178231
        этикетка: gk343830
      -
        класс: вариация
        id: WBVar01178240
        этикетка: gk7
      -
        класс: вариация
        id: WBVar01178242
        этикетка: gk715591
      -
        класс: вариация
        id: WBVar01498554
        этикетка: gk963311
      -
        класс: вариация
        id: WBVar01178241
        этикетка: gk675576
      -
        класс: вариация
        id: WBVar01178230
        этикетка: gk369562
      -
        класс: вариация
        id: WBVar00088158
        этикетка: ju91
    мертв: !! perl / скаляр: JSON :: PP :: Boolean 0
    Описание: Обеспечивает активность связывания киназы киназы, активируемой митогеном, протеинкиназы.Участвует в нескольких процессах, в том числе в активации активности MAPK; каскад p38MAPK; и регулирование роста в процессе развития. Находится в цитоплазме. Выражается в голове; нейроны; и глотка. Человеческий ортолог (ы) этого гена вовлечен в несколько заболеваний, включая инвазивную протоковую карциному; серозная карцинома яичников; и карцинома простаты in situ. Является ортологом человеческого MAP2K4 (митоген-активированная протеинкиназа киназа 4).
    этикетка: мкк-4
    legacy_description: mkk-4 кодирует киназу киназы MAP (митоген-активированный протеин), которая является членом семейства MKK4 MAPKK; Активность MKK-4 требуется в пресинаптических нейронах дозозависимым образом для нормального пресинаптического развития и морфологии; в регуляции пресинаптической организации MKK-4 действует выше PMK-3 / MAPK и ниже DLK-1 / MAPKKK, уровни которых негативно регулируются убиквитинлигазой RPM-1; функциональный слитый белок MKK-4 :: GFP экспрессируется в цитоплазме многих нейронов, а также в других типах клеток, включая мышцы глотки.merged_into: ~
    имя:
      класс: ген
      выделять:
        description_all:
          - Является ортологом человеческого MAP2K4 (митоген-активированная протеинкиназа киназа  4 ).
          -  mkk  -  4  кодирует киназу киназы MAP (митоген-активированный протеин), которая является членом семейства MKK4
          - МАПКК;  MKK  -  4  активность требуется в пресинаптических нейронах дозозависимым образом для нормального пресинаптического
          - развитие и морфология; регулируя пресинаптическую организацию,  MKK  -  4  действует выше PMK-3 / MAPK
          - DLK-1 / MAPKKK, уровни которых негативно регулируются убиквитинлигазой RPM-1; функциональный  MKK 
        метка:
          -  мкк  -  4 
      id: WBGene00003368
      этикетка: мкк-4
      другие имена:
        - F42G10.2
        - CELE_F42G10.2
        - F42G10.2.1
        - CE10328
        - F42G10.2
      таксономия: c_elegans
    другие имена:
      - F42G10.2
      - CELE_F42G10.2
      - F42G10.2.1
      - CE10328
      - F42G10.2
    page_type: ген
    разновидность:
      ключ: c_elegans
      название: Caenorhabditis elegans
    таксономия:
      род: Caenorhabditis
      id: c_elegans
      виды: elegans
    wbid: WBGene00003368
  -
    описание: "[rCes F42G10.2 :: GFP + pCeh461]"
    этикетка: sEx12103
    имя:
      класс: трансген
      выделять:
        другие имена:
          - "[ mkk  -  4  :: gfp]"
      id: WBTransgene00002819
      этикетка: sEx12103
      другие имена:
        - "[mkk-4 :: gfp]"
      таксономия: ~
    другие имена:
      - "[mkk-4 :: gfp]"
    page_type: трансген
    виды: ~
    таксономия: ~
    wbid: WBTransgene00002819
  -
    описание: ~
    этикетка: «F01F1.3: мкк-4 "
    имя:
      класс: взаимодействие
      выделять:
        метка:
          - "F01F1.3:  мкк  -  4 "
      id: WBInteraction000279542
      этикетка: "F01F1.3: mkk-4"
      other_names: ~
      таксономия: ~
    page_type: взаимодействие
    таксономия: ~
    wbid: WBInteraction000279542
  -
    описание: ~
    этикетка: "B0238.13: mkk-4"
    имя:
      класс: взаимодействие
      выделять:
        метка:
          - "B0238.13:  мкк  -  4 "
      id: WBInteraction000403231
      этикетка: «B0238.13: мкк-4 "
      other_names: ~
      таксономия: ~
    page_type: взаимодействие
    таксономия: ~
    wbid: WBInteraction000403231
  -
    описание: ~
    этикетка: "C16D9.8: mkk-4"
    имя:
      класс: взаимодействие
      выделять:
        метка:
          - "C16D9.8:  мкк  -  4 "
      id: WBInteraction000236952
      этикетка: "C16D9.8: mkk-4"
      other_names: ~
      таксономия: ~
    page_type: взаимодействие
    таксономия: ~
    wbid: WBInteraction000236952
  -
    описание: ~
    этикетка: «К11Д12.8: мкк-4 "
    имя:
      класс: взаимодействие
      выделять:
        метка:
          - "K11D12.8:  мкк  -  4 "
      id: WBInteraction000275683
      этикетка: «К11Д12.8: мкк-4»
      other_names: ~
      таксономия: ~
    page_type: взаимодействие
    таксономия: ~
    wbid: WBInteraction000275683
  -
    описание: ~
    этикетка: "C18A11.1: mkk-4"
    имя:
      класс: взаимодействие
      выделять:
        метка:
          - "C18A11.1:  мкк  -  4 "
      id: WBInteraction000380407
      этикетка: «C18A11.1: мкк-4 "
      other_names: ~
      таксономия: ~
    page_type: взаимодействие
    таксономия: ~
    wbid: WBInteraction000380407
  -
    описание: ~
    этикетка: «С25х4.10: мкк-4»
    имя:
      класс: взаимодействие
      выделять:
        метка:
          - "C25h4.10:  мкк  -  4 "
      id: WBInteraction000455412
      этикетка: «С25х4.10: мкк-4»
      other_names: ~
      таксономия: ~
    page_type: взаимодействие
    таксономия: ~
    wbid: WBInteraction000455412
  -
    описание: ~
    этикетка: "atf-2: mkk-4"
    имя:
      класс: взаимодействие
      выделять:
        метка:
          - "atf-2:  mkk  -  4 "
      id: WBInteraction000122770
      этикетка: "atf-2: mkk-4"
      other_names: ~
      таксономия: ~
    page_type: взаимодействие
    таксономия: ~
    wbid: WBInteraction000122770
виды: ~
тип: все? content-type = text
uri: search / gene / mkk-4 / all% 3Fcontent-type = text / html
 
.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *