Замена кт829а: Страница не найдена – СхемаТок

alexxlab | 23.01.1982 | 0 | Разное

Содержание

d2092 чем можно заменить – ComputerMaker.info

Автор admin На чтение 6 мин.

Биполярный транзистор KTD2092 — описание производителя. Основные параметры. Даташиты.

Наименование производителя: KTD2092

Тип материала: Si

Максимальная рассеиваемая мощность (Pc): 25 W

Макcимально допустимое напряжение коллектор-эмиттер (Uce): 80 V

Макcимальный постоянный ток коллектора (Ic): 3 A

Предельная температура PN-перехода (Tj): 175 °C

Статический коэффициент передачи тока (hfe): 500

Корпус транзистора: ISO220

KTD2092 Datasheet (PDF)

SEMICONDUCTOR KTD2092 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR SWITCHING APPLICATION. INTERFACE CIRCUIT AND DRIVER CIRCUIT APPLICATION. A C DIM MILLIMETERS S FEATURES _ A 10.0 0.3 + _ + B 15.0 0.3 E High hFE : hFE=500 1500 (IC=0.5A). C _ 2.70 0.3 + D 0.76+0.09/-0.05 Low Collector Saturation :VCE(sat)=0.35V(Max.) (IC=1A). _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.

5.1. ktd2017.pdf Size:46K _update_mosfet

SMD Type IC SMD Type IC N-Channel Silicon MOSFET KTD2017 TSSOP-8 Unit: mm Features Low ON resistance. 2.5V drive. Mounting height 1.1mm Composite type, facilitating high-density mounting. 5: Gate2 1: Drain1 6 : Source2 2 : Source1 7 : Source2 3 : Source1 8: Drain2 4: Gate1 Absolute Maximum Ratings Ta = 25 Parameter Symbol Rating Unit Drain-to-Source Voltage VDSS 20 V Gate-

5.2. ktd2005.pdf Size:47K _update_mosfet

SMD Type IC SMD Type IC Ultrahigh-Speed Switching Applications KTD2005 TSSOP-8 Unit: mm Features Low ON resistance. 2.5V drive. Mounting height 1.1mm. Composite type, facilitating high-density mounting. 5: Gate2 1: Drain1 6 : Source2 2 : Source1 7 : Source2 3 : Source1 8: Drain2 4: Gate1 Absolute Maximum Ratings Ta = 25 Parameter Symbol Rating Unit Drain-to-Source Voltage V

SEMICONDUCTOR KTD2066 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR HIGH CURRENT SWITCHING APPLICATION. LAMP SOLENO >5.4. ktd2058.pdf Size:40K _kec

SEMICONDUCTOR KTD2058 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S ·Low Saturation Voltage _ A 10.0 0.3 + _ + B 15.0 0.3 E : VCE(sat)=1.0V(Max.) at IC=2A, IB=0.2A. C _ 2.70 0.3 + D 0.76+0.09/-0.05 ·Complementary to KTB1366. _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + H 0.5+0.1/-0.05 _ + J 13.6 0.5

SEMICONDUCTOR KTD2060 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S Good Linearity of hFE. _ A 10.0 0.3 + _ + B 15.0 0.3 E Complementary to KTB1368. C _ 2.70 0.3 + D 0.76+0.09/-0.05 _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + H 0.5+0.1/-0.05 _ + J 13.6 0.5 L L MAXIMUM RATING (Ta=25 ) R K _ 3.7 0.

SEMICONDUCTOR KTD2059 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S Complementary to KTB1367. _ A 10.0 0.3 + _ + B 15.0 0.3 E C _ 2.70 0.3 + D 0.76+0.09/-0.05 _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + MAXIMUM RATING (Ta=25 ) H 0.5+0.1/-0.05 _ + J 13.6 0.5 L L CHARACTERISTIC SYMBOL RATING UNIT R

SEMICONDUCTOR KTD2061 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR HIGH VOLTAGE APPLICATION TV, MONITOR VERTICAL OUTPUT APPLICATION A C DRIVER STAGE APPLICATION DIM MILLIMETERS S COROR TV >5.8. ktd2058.pdf Size:198K _lge

KTD2058(NPN) TO-220 Transistor TO-220 1. BASE 2. COLLECTOTR 3. EMITTER 3 2 1 Features Low Collector Saturation Voltage : VCE(SAT) = 1. 0V(MAX) . Dimensions in inches and (millimeters) MAXIMUM RATINGS (TA=25? unless otherwise noted) Symbol Parameter Value Units VCBO Collector-Base Voltage 60 V VCEO Collector-Emitter Voltage 60 V VEBO Emitter-Base Voltage 7 V IC C

Биполярный транзистор KTD2092 — описание производителя. Основные параметры. Даташиты.

Наименование производителя: KTD2092

Тип материала: Si

Максимальная рассеиваемая мощность (Pc): 25 W

Макcимально допустимое напряжение коллектор-эмиттер (Uce): 80 V

Макcимальный постоянный ток коллектора (Ic): 3 A

Предельная температура PN-перехода (Tj): 175 °C

Статический коэффициент передачи тока (hfe): 500

Корпус транзистора: ISO220

KTD2092 Datasheet (PDF)

SEMICONDUCTOR KTD2092 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR SWITCHING APPLICATION. INTERFACE CIRCUIT AND DRIVER CIRCUIT APPLICATION. A C DIM MILLIMETERS S FEATURES _ A 10.0 0.3 + _ + B 15.0 0.3 E High hFE : hFE=500 1500 (IC=0.5A). C _ 2.70 0.3 + D 0.76+0.09/-0.05 Low Collector Saturation :VCE(sat)=0.35V(Max.) (IC=1A). _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.

5.1. ktd2017.pdf Size:46K _update_mosfet

SMD Type IC SMD Type IC N-Channel Silicon MOSFET KTD2017 TSSOP-8 Unit: mm Features Low ON resistance. 2.5V drive. Mounting height 1.1mm Composite type, facilitating high-density mounting. 5: Gate2 1: Drain1 6 : Source2 2 : Source1 7 : Source2 3 : Source1 8: Drain2 4: Gate1 Absolute Maximum Ratings Ta = 25 Parameter Symbol Rating Unit Drain-to-Source Voltage VDSS 20 V Gate-

5.2. ktd2005.pdf Size:47K _update_mosfet

SMD Type IC SMD Type IC Ultrahigh-Speed Switching Applications KTD2005 TSSOP-8 Unit: mm Features Low ON resistance. 2.5V drive. Mounting height 1.1mm. Composite type, facilitating high-density mounting. 5: Gate2 1: Drain1 6 : Source2 2 : Source1 7 : Source2 3 : Source1 8: Drain2 4: Gate1 Absolute Maximum Ratings Ta = 25 Parameter Symbol Rating Unit Drain-to-Source Voltage V

SEMICONDUCTOR KTD2066 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR HIGH CURRENT SWITCHING APPLICATION. LAMP SOLENO >5.4. ktd2058.pdf Size:40K _kec

SEMICONDUCTOR KTD2058 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S ·Low Saturation Voltage _ A 10.0 0.3 + _ + B 15.0 0.3 E : VCE(sat)=1.0V(Max.) at IC=2A, IB=0.2A. C _ 2.70 0.3 + D 0.76+0.09/-0.05 ·Complementary to KTB1366. _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + H 0.5+0.1/-0.05 _ + J 13.6 0.5

SEMICONDUCTOR KTD2060 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S Good Linearity of hFE. _ A 10.0 0.3 + _ + B 15.0 0.3 E Complementary to KTB1368. C _ 2.70 0.3 + D 0.76+0.09/-0.05 _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + H 0.5+0.1/-0.05 _ + J 13.6 0.5 L L MAXIMUM RATING (Ta=25 ) R K _ 3.7 0.

SEMICONDUCTOR KTD2059 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S Complementary to KTB1367. _ A 10.0 0.3 + _ + B 15.0 0.3 E C _ 2.70 0.3 + D 0.76+0.09/-0.05 _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + MAXIMUM RATING (Ta=25 ) H 0.5+0.1/-0.05 _ + J 13.6 0.5 L L CHARACTERISTIC SYMBOL RATING UNIT R

SEMICONDUCTOR KTD2061 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR HIGH VOLTAGE APPLICATION TV, MONITOR VERTICAL OUTPUT APPLICATION A C DRIVER STAGE APPLICATION DIM MILLIMETERS S COROR TV >5.8. ktd2058.pdf Size:198K _lge

KTD2058(NPN) TO-220 Transistor TO-220 1. BASE 2. COLLECTOTR 3. EMITTER 3 2 1 Features Low Collector Saturation Voltage : VCE(SAT) = 1. 0V(MAX) . Dimensions in inches and (millimeters) MAXIMUM RATINGS (TA=25? unless otherwise noted) Symbol Parameter Value Units VCBO Collector-Base Voltage 60 V VCEO Collector-Emitter Voltage 60 V VEBO Emitter-Base Voltage 7 V IC C

Замена транзистора 2SC3852

Замена 2SC3852 на отечественный аналог. Довольно часто при ремонте блоков питания телевизоров на микросхемах STR-S6707 (например телевизоры LG, Goldstar) вместе с заменой микросхемы STR-S6707 возникает необходимость замены транзистора 2SC3852 или KSD2092.
Аналогом 2SC3852 и KSD2092, является наш отечественный транзистор КТ829А .

Даташит на 2SC3852

При этом никаких переделок на плате делать не приходится, впаивается вместо неисправного. Единственное на что следует обратить внимание при замене транзистора 2SC3852, он в изолированном корпусе, а транзистор КТ829А – нет. Проверьте радиатор к которому крепится 2SC3852, если он имеет соединение с шиной (минусом), то необходимо поставить изолирующую прокладку.

Транзистор кт837 характеристики цоколевка – Строительство домов и бань

КТ837Аp-n-p80607500(30)10-40150«>1КТ837Б80607500(30)20-80150«>1КТ837В80607500(30)50-150150«>1КТ837Г60457500(30)10-40150«>1КТ837Д60457500(30)20-80150«>1КТ837Е60457500(30)50-150150«>1КТ837Ж45307500(30)10-40150«>1КТ837И45307500(30)20-80150«>1КТ837К45307500(30)50-150150«>1КТ837Л80607500(30)10-40150«>1КТ837М80607500(30)20-80150«>1КТ837Н80607500(30)50-150150«>1КТ837П60457500(30)10-40150«>1КТ837Р60457500(30)20-80150«>1КТ837С60457500(30)50-150150«>1КТ837Т45307500(30)10-40150«>1КТ837У45307500(30)20-80150«>1КТ837Ф45307500(30)50-150150«>1

Корпус:

Uкбо— Максимально допустимое напряжение коллектор-база
Uкбои— Максимально допустимое импульсное напряжение коллектор-база
Uкэо— Максимально допустимое напряжение коллектор-эмиттер
Uкэои— Максимально допустимое импульсное напряжение коллектор-эмиттер
Iкmax— Максимально допустимый постоянный ток коллектора
Iкmax и— Максимально допустимый импульсный ток коллектора
Pкmax— Максимально допустимая постоянная рассеиваемая мощность коллектора без теплоотвода
Pкmax т— Максимально допустимая постоянная рассеиваемая мощность коллектора с теплоотводом
h21э— Статический коэффициент передачи тока биполярного транзистора в схеме с общим эмиттером
Iкбо— Обратный ток коллектора
fгр— граничная частота коэффициента передачи тока в схеме с общим эмиттером
Uкэн— напряжение насыщения коллектор-эмиттер

Я помню, эти транзиторы использовались в качестве выходных силовых стабилизаторов напряжения лампово-полупроводниковых телевизоров и более современных конца 80-х. середины 90-х, телевизорах 2-го и 3-го поколения с импульсными источниками питания в качестве стабилизаторов напряжения по линии 12В. Отличные, надежные приборы. У меня установлен в самодельном стабилизаторе напряжения, все идеально, не забывайте только при работе о рассеиваемой мощности, устанавливайте на радиатор 🙂

Эти транзисторы были специально разработаны для замены германиевых транзисторов П213. П217 и являются их полными аналогами. В первых пачках этих транзисторов даже лежал вкладыш с таблицей, где было написано, что в связи с нехваткой германия.
А также была таблица соответствия транзисторов КТ837 с определённой буквой транзисторам П213-П217. Вот бы эту таблицу найти!

На «ЖИГУЛЕ» в реле зарядки 121.3702 КТ837Ф замкнул второй раз за три года.

Хотелось бы и проводимость узнать (прямая или обратная)!

КТ837 , 2Т837 (кремниевый транзистор, p-n-p)

КТ837Ф

В наличии лишь 1

  • Описание
  • Отзывы (0)

Описание

КТ837Ф

Транзисторы КТ837Ф кремниевые эпитаксиально-диффузионные структуры p-n-p переключательные.
Предназначены для применения в усилителях и переключающих устройствах.
Корпус пластмассовый с жесткими выводами.
Масса транзистора не более 2,5 г.
Тип корпуса: КТ-28 (ТО-220).
Технические условия: аА0.336.403 ТУ.

Основные технические характеристики транзистора КТ837Ф:

• Структура транзистора: p-n-p;
• Рк т max — Постоянная рассеиваемая мощность коллектора с теплоотводом: 30 Вт;
• fгр — Граничная частота коэффициента передачи тока транзистора для схемы с общим эмиттером: не менее 1 МГц;
• Uкбо max — Максимальное напряжение коллектор-база при заданном обратном токе коллектора и разомкнутой цепи эмиттера: 450 В;
• Uэбо max — Максимальное напряжение эмиттер-база при заданном обратном токе эмиттера и разомкнутой цепи коллектора: 5 В;
• Iк max — Максимально допустимый постоянный ток коллектора: 7,5 А;
• Iкбо — Обратный ток коллектора — ток через коллекторный переход при заданном обратном напряжении коллектор-база и разомкнутом выводе эмиттера: не более 0,15 мА;
• h31э — Статический коэффициент передачи тока транзистора для схем с общим эмиттером: 50… 150;
• Rкэ нас — Сопротивление насыщения между коллектором и эмиттером: не более 0,25 Ом

Характеристики транзисторов КТ837А, КТ837Б, КТ837В, КТ837Г, КТ837Д, КТ837Е, КТ837Ж, КТ837И, КТ837К, КТ837Л, КТ837М, КТ837Н, КТ837П, КТ837Р, КТ837С, КТ837Т, КТ837У, КТ837Ф, КТ837Х:

Тип
транзистора
СтруктураПредельные значения параметров при Тп=25°СЗначения параметров при Тп=25°С
max
Т
max

max
IК. И.
max
UКЭR max
(UКЭ0 max)
UКБ0 maxUЭБ0 maxРК max
(РК. Т. max)
h31ЭUКЭ
нас.
IКБОIЭБОIКЭRf гp.СКСЭ
ААВВBВтВмАмAмАМГцпФпФ°С°С
КТ837Аp-n-p7,57080151 (30)10…401125-60…+100
КТ837Бp-n-p7,57080151 (30)20…801125-60…+100
КТ837Вp-n-p7,57080151 (30)50…1501125-60…+100
КТ837Гp-n-p7,55560151 (30)10…401125-60…+100
КТ837Дp-n-p7,55560151 (30)20…801125-60…+100
КТ837Еp-n-p7,55560151 (30)50…1501125-60…+100
КТ837Жp-n-p7,54045151 (30)10…401125-60…+100
КТ837Иp-n-p7,54045151 (30)20…801125-60…+100
КТ837Кp-n-p7,54045151 (30)50…1501125-60…+100
КТ837Лp-n-p7,5708051 (30)10…401125-60…+100
КТ837Мp-n-p7,5708051 (30)20…801125-60…+100
КТ837Нp-n-p7,5708051 (30)50…1501125-60…+100
КТ837Пp-n-p7,5556051 (30)10…401125-60…+100
КТ837Рp-n-p7,5556051 (30)20…801125-60…+100
КТ837Сp-n-p7,5556051 (30)50…1501125-60…+100
КТ837Тp-n-p7,5404551 (30)10…401125-60…+100
КТ837Уp-n-p7,5404551 (30)20…801125-60…+100
КТ837Фp-n-p7,5404551 (30)50…1501125-60…+100
КТ837Хp-n-p7,518018051 (30)>151125-60…+100

Условные обозначения электрических параметров транзисторов:

IК max — максимально допустимый постоянный ток коллектора транзистора.
IК. И. max — максимально допустимый импульсный ток коллектора транзистора.
UКЭR max — максимальное напряжение между коллектором и эмиттером при заданном токе коллектора и сопротивлении в цепи база-эмиттер.
UКЭ0 max — максимальное напряжение между коллектором и эмиттером транзистора при заданном токе коллектора и токе базы, равным нулю.
UКБ0 max — максимальное напряжение коллектор-база при заданном токе коллектора и токе эмиттера, равным нулю.
UЭБ0 max — максимально допустимое постоянное напряжение эмиттер-база при токе коллектора, равном нулю.
РК max — максимально допустимая постоянная мощность, рассеивающаяся на коллекторе транзистора.
РК. Т. max — максимально допустимая постоянная мощность, рассеивающаяся на коллекторе транзистора с теплоотводом.
h31Э — статический коэффициент передачи тока биполярного транзистора.
UКЭ нас. — напряжение насыщения между коллектором и эмиттером транзистора.
IКБО— обратный ток коллектора. Ток через коллекторный переход при заданном обратном напряжении коллектор-база и разомкнутом выводе эмиттера.
IЭБО— обратный ток эмиттера. Ток через эмиттерный переход при заданном обратном напряжении эмиттер-база и разомкнутом выводе коллектора.
IКЭR — обратный ток коллектор-эмиттер при заданном обратном напряжении коллектор-эмиттер и сопротивлении в цепи база-эмиттер.
f гр — граничная частота коэффициента передачи тока.
СК — емкость коллекторного перехода.
СЭ — емкость коллекторного перехода.
ТП max — максимально допустимая температура перехода.
Т max — максимально допустимая температура окружающей среды.

Отзывы

Отзывов пока нет.

Только зарегистрированные клиенты, купившие этот товар, могут публиковать отзывы.

Транзистор кт837 характеристики цоколевка

ГлавнаяО сайтеТеорияПрактикаКонтакты

Высказывания:
Творческое мышление, возможно, означает всего-навсего понимание, что нет никакой особой добродетели в том, чтобы вести дела так, как их всегда вели до нас.

Основные параметры биполярного низкочастотного pnp транзистора КТ837Р

Эта страница создана пользователем сайта через систему Коллективного разума и показывает существующую справочную информацию о параметрах биполярного низкочастотного pnp транзистора КТ837Р . Информация о параметрах, цоколевке, характеристиках, местах продажи и производителях.

Исходный полупроводниковый материал, на основе которого изготовлен транзистор:
Структура полупроводникового перехода: pnp

Pc max, мВтUcb max, ВUce max, ВUeb max, ВIc max, мАTj max, °CFt max, ГцCc tip, пФHfe
300006055575001000000

Производитель: Интеграл
Сфера применения:
Популярность: 567
Дополнительные параметры транзистора КТ837Р: Корпус: TO-220.
Условные обозначения описаны на странице «Теория».

Схемы транзистора КТ837Р

Общий вид транзистора КТ837Р.Цоколевка транзистора КТ837Р.

Обозначение контактов:
Международное: C — коллектор, B — база, E — эмиттер.
Российское: К — коллектор, Б — база, Э — эмиттер.

Дата создания страницы: 2016-08-25 11:24:37.

Коллективный разум. Дополнения для транзистора КТ837Р.

Другие разделы справочника:

Есть надежда, что справочник транзисторов окажется полезен опытным и начинающим радиолюбителям, конструкторам и учащимся. Всем тем, кто так или иначе сталкивается с необходимостью узнать больше о параметрах транзисторов. Более подробную информацию обо всех возможностях этого интернет-справочника можно прочитать на странице «О сайте».
Если Вы заметили ошибку, огромная просьба написать письмо.
Спасибо за терпение и сотрудничество.

Транзисторы КТ837(2Т837)

Т ранзисторы КТ837(2Т837) — кремниевые, мощные, низкочастотные, структуры — p-n-p.
Корпус металло-пластик. Маркировка буквенно — цифровая.

Наиболее важные параметры.

Коэффициент передачи тока У транзисторов КТ837А, КТ837Б, КТ837Г, КТ837Д, КТ837Ж, КТ837И, КТ837Т — от 10 до 40
У транзисторов КТ837В, КТ837Е, КТ837К, КТ837М, КТ837П, КТ837У — от 20 до 80
У транзисторов КТ837Н, КТ837Ф — от 50 до 150
У транзисторов 2Т837А, 2Т837Г — от 15 до 120
У транзисторов 2Т837Б, 2Т837Д — от 30 до 150
У транзисторов 2Т837В, 2Т837Е — от 40 до 180

Граничная частота передачи тока.3МГц.

Максимальное напряжение коллектор — эмиттер. У транзисторов КТ837А, КТ837Б, КТ837В, КТ837М, КТ837Л, КТ837Н — 60 в.
У транзисторов КТ837Г, КТ837Д, КТ837Е, КТ837П, КТ837Р, КТ837С — 45 в.
У транзисторов КТ837Ж, КТ837И, КТ837К, КТ837Т, КТ837У, КТ837Ф — 30 в.
У транзисторов 2Т837А, 2Т837Г — 55 в.
У транзисторов 2Т837Д, 2Т837Б — 45 в.
У транзисторов 2Т837В, 2Т837Е — 35 в.

Максимальный ток коллектора(постоянный). У всех транзисторов КТ837 — 7,5 А.
У всех транзисторов 2Т837 — 8 А.

Напряжение насыщения коллектор-эмиттер.
У транзисторов КТ837А, КТ837Б, КТ837В, КТ837Ж, КТ837К, КТ837Л, КТ837М, КТ837Н — не более 2,5 в.
У транзисторов КТ837Г, КТ837Д, КТ837Е, КТ837Т, КТ837У, КТ837Ф — не более 0,5 в.
У транзисторов КТ837П, КТ837Р, КТ837С — не более 0,9 в.

Обратный ток коллектора. — не более 0,15 мА.

Рассеиваемая мощность коллектора.30 Вт(с радиатором).

Зарубежные аналоги транзисторов КТ837

КТ837А — 2SD685
КТ837Б — 2T7534C
КТ837В — 2SB834, 2SB906
КТ837Д — 2N6111

Транзисторы КТ829

Транзисторы КТ829 — кремниевые, мощные, низкочастотные,составные(схема Дарлингтона) структуры — n-p-n.
Корпус металло-пластиковый. Применяются в усилительных и генераторных схемах.

Внешний вид и расположение выводов на рисунке:

Наиболее важные параметры.

Коэффициент передачи тока — 750.

Максимально допустимое напряжение коллектор-эмиттер:
У транзисторов КТ829А — 100в.
У транзисторов КТ829Б — 80в.
У транзисторов КТ829А — 60в.
У транзисторов КТ829Г — 45в.

Максимальный ток коллектора8 А.

Обратный ток коллектор-эмиттер при напряжении эмиттер-коллектор близкому к максимальному и температуре окружающей среды от -60 до +25 по Цельсию — не более 1,5 мА.
При температуре окружающей среды +85 по Цельсию — не более 3 мА.

Обратный ток эмиттера при напряжении база-эмиттер 5в — не более 2 мА.

Напряжение насыщения коллектор-эмиттер при коллекторном токе 3,5А и базовом 14мА — не более 2 в.

Напряжение насыщения база-эмиттер при коллекторном токе 3,5А и базовом 14мА:
— не более 2,5 в.

Рассеиваемая мощность коллектора.60 Вт(с радиатором).

Граничная частота передачи тока — 4 МГц.

Зарубежные аналоги транзисторов КТ829

КТ829А — 2SD686
КТ829Б — BD263
КТ829В — TIP122
КТ829Д — BDX53E

Особености проверки(прозвонки)на целосность транзисторов КТ829.

Так как транзистор КТ829 является составным, его вполне можно заменить несложной схемой КТ817+КТ819.

Не удивительно, что при проверки тестером переход база-эмиттер будет звониться в обе стороны, причем у разных КТ829 может наблюдаться значительный разброс по значению обратного сопротивления. От суммы сопротивлений изображенных в схеме на картинке, до гораздо меньших значений (7 кОм, к примеру). Отчего разброс так велик, автору доподлинно не известно, но то что на работоспособность КТ829 это влияет незначительно — это точно. Ведь имеющееся сопротивление эмиттер-база всего лишь слегка «подпирает» транзистор.

Транзисторы — купить. или найти бесплатно.

Где сейчас можно найти советские транзисторы?
В основном здесь два варианта — либо купить, либо — получить бесплатно, в ходе разборки старого электронного хлама.

Во время промышленного коллапса начала 90-х? образовались довольно значительные запасы некоторых электронных комплектующих. Кроме того, полностью производство отечественных электронных никогда не прекращалось и не прекращается по сей день. Это и обьясняет тот факт, что очень многие детали прошедшей эпохи, все таки — можно купить. Если же нет — всегда имеются более-менее современные импортные аналоги. Где и как проще всего купить транзисторы? Если получилось так, что поблизости от вас нет специализированного магазина, то можно попробовать приобрести необходимые детали, заказав их по почте. Сделать это можно зайдя на сайт-магазин, например — «Гулливер».

Если же у вас, имеется какая-то старая, ненужная техника — можно попытаться выпаять необходимые транзисторы из ее схем.
Например, транзисторы КТ837 можно обнаружить в блоке усилителя активной акустической системы 35АС-013(Радиотехника S-70).
в усилителях «Радиотехника У-7101 стерео,» «Радиотехника У-101 стерео.» На главную страницу
В начало

Использование каких — либо материалов этой страницы, допускается при наличии ссылки на сайт «Электрика это просто».

Описание «КТ837Ф»

КТ837Ф
Транзисторы КТ837Ф кремниевые эпитаксиально-диффузионные структуры p-n-p переключательные.
Предназначены для применения в усилителях и переключающих устройствах.
Корпус пластмассовый с жесткими выводами.
Масса транзистора не более 2,5 г.

Основные технические характеристики транзистора КТ837Ф:
• Структура транзистора: p-n-p;
• Рк т max — Постоянная рассеиваемая мощность коллектора с теплоотводом: 30 Вт;
• fгр — Граничная частота коэффициента передачи тока транзистора для схемы с общим эмиттером: не менее 1 МГц;
• Uкбо max — Максимальное напряжение коллектор-база при заданном обратном токе коллектора и разомкнутой цепи эмиттера: 450 В;
• Uэбо max — Максимальное напряжение эмиттер-база при заданном обратном токе эмиттера и разомкнутой цепи коллектора: 5 В;
• Iк max — Максимально допустимый постоянный ток коллектора: 7,5 А;
• Iкбо — Обратный ток коллектора — ток через коллекторный переход при заданном обратном напряжении коллектор-база и разомкнутом выводе эмиттера: не более 0,15 мА;
• h31э — Статический коэффициент передачи тока транзистора для схем с общим эмиттером: 50. 150;
• Rкэ нас — Сопротивление насыщения между коллектором и эмиттером: не более 0,25 Ом

Оценка статьи:

Загрузка…Транзистор кт837 характеристики цоколевка Ссылка на основную публикацию wpDiscuzAdblock
detector

Схема управления шаговым двигателем

5 723

Когда то, кто то меня спрашивал об управлении мощным шаговым двигателем.
Двигатель использован от старинного кассового аппарата — ДШР-39, возможна так же замена на китайский — ДШИ-200, с заменой транзисторов КТ829А на более мощные или приспособить их на радиатор.


Зачем изобрели шаговый двигатель? Такой двигатель незаменим при конструировании точных устройств позиционирования.
Многие из подобных двигателей имеют на статоре по две многополюсные сдвинутые относительно друг друга обмотки, каждая из них со средним выводом.
Последние обычно соединяют с полюсом источника питания, а остальные в определенной последовательности — с минусом. Когда через одну из половин обмотки течет ток , ее вторая половина обесточена. Предлагаемое устройство управляет шаговым двигателем, заставляя его ротор вращаться в одну или другую сторону. Каждый из импульсов генератора на элементах микросхемы DD1 поворачивает ротор на один шаг. Частоту импульсов изменяют переменным резистором R3.

Нужную последовательность уровней напряжения, подаваемых на обмотки двигателя, формирует кольцевой двухразрядный счетчик на D – триггерах DD3.1 и DD3.2. С помощью двух элементов «Исключающее ИЛИ» DD2.3 и DD2.4 при необходимости инвертируют сигналы обратной связи счетчика изменяя таким образом направление счета и вращения ротора двигателя М1 в зависимости от положения выключателя S1. Элементы DD2.1 и DD2.2 – буферные.

Непосредственно коммутируют обмотки двигателя транзисторные ключи VT1-VT4. Мощность двигателя M1 ограничена максимальным током через один ключ. В этом варианте были взяты транзисторы КТ829А, но подойдут любые другие аналоги.

Несколько раз слышал, что данная схема имеет большие потери. Как вариант можно и Китайский блок управления купить, но опять же уже и двигатель брать там же… Иначе может выйти чего не так.

Если есть желание поэкспериментировать, то макет печатной платы в формате тут DipTrace.

Регулятор напряжения 1702.3702-01

Усовершенствование стабилизаторов Я112, Я120

категория

Электронные самоделки в помощь автолюбителю

В. ДОБРОЛЮБОВ, г. Королев Московской облРадио, 2000 год, №2

Установлено, что аккумуляторная батарея служит надежнее и дольше, если регулятор системы электрооборудования поддерживает бортовое напряжение, изменяющееся в определенной зависимости от температуры. Серийная же автомобильная аппаратура этого обеспечить не может. Автору публикуемой статьи удалось простыми средствами получить близкий к оптимальному температурный коэффициент бортового напряжения.

Во всех отечественных автомобилях в качестве регулятора напряжения генератора используются стабилизаторы типа Я112, Я120 (так называемые «шоколадки»).

И их главным недостатком является то, что они не обеспечивают необходимой температурной зависимости бортового напряжения .

На рис. 1 показана типовая схема традиционно построенного порогового узла стабилизатора напряжения. Закон изменения стабилизируемого напряжения здесь в основном определяет кремниевый стабилитрон VD1, а он ни по значению, ни по знаку температурного коэффициента напряжения стабилизации не соответствует решению задачи.

Это приводит к тому, что летом кипит электролит в аккумуляторной батарее, а в хоподное время года она остается недозаряженной.

Предлагаю пороговый узел стабилизатора напряжения построить несколько иначе (рис. 2). В этом варианте пороговым элементом по-прежнему служит транзистор VT1, а стабистор VD1 работает в стандартном режиме, обеспечиваемом резистором R4. Легко видеть, что ток через стабистор мало зависит от тока базы транзистора.

При напряжении Uпит. меньшем установленного, транзистор закрыт падением напряжения на стабисторе Когда напряжение Uпит, увеличиваясь, достигнет установленного значения, напряжение на базе станет достаточным для открывания транзистора.

С описанным вариантом порогового узла был изготовлен и опробован образец бортового стабилизатора напряжения для легкового автомобиля. Схема устройства показана на рис. 3. Стабилизатор был установлен на генератор 29.3701 взамен демонтированного R112.

Пока бортовое напряжение мало, транзистор VT1 закрыт, а VT2 — открыт. Через обмотку возбуждения генератора течет ток. поэтому напряжение Uпит, увеличивается. Как только оно превысит пороговый уровень, транзистор VТ1 откроется, а VT2 закроется — напряжение начинает уменьшаться до момента закрывания транзистора VТ1.

Необходимый для устойчивой работы стабилизатора электрический «гистерезис» по коммутации транзисторов в стабилизаторе получается автоматически из-за ненулевого сопротивления соединительных проводников. По этой причине входной делитель напряжения R1R2 не следует подключать непосредственно к выводу аккумуляторной бата реи, как это часто рекомендуют для повышения стабильности напряжения.

Диод VD2 предназначен для надежного закрывания транзистора VT2, когда транзистор VT1 открыт. Диод VDЗ гасит всплески напряжения самоиндукции обмотки возбуждения генератора при закрывании транзистора VТ2.

Стабилизатор собран на печатной плате из фольгированного стеклотекстолита толщиной 1,5 мм. Чертеж платы представлен на рис. 4. Транзистор КТ829А можно заменить на КТ890А.

Необходимое напряжение переключения стабилизатора устанавливают при налаживании подборкой резистора R2. Процесс налаживания многократно описан в журнале (например, в работе ), поэтому здесь опущен. С правильно отрегулированным стабилизатором при температуре +40°С напряжение, поддерживаемое генератором, равно 13,6 В. а при -20°С — 14,5 В.

Испытания показали, что нестабильность напряжения не превышала ±1.5 %. У стабилизатора с традиционным пороговым узлом этот показатель достигал ±5 %.

ЛИТЕРАТУРА1. Ломанович В. Термокомпенсированный регулятор напряжения. — Радио, 1985. № 5. с. 24 — 27.2. Бирюков С. Простой термокомпенсированный регулятор напряжения. — Радио, 1994. № 1.с.34,35:№ 10, с. 43.3. Коробков А. Автомобильный регулятор напряжения. — Радио, 1986. № 4, с. 44,45.

От редакции. Лучших результатов в работе стабилизатора можно добиться, если обеспечить тепловой контакт транзистора VT1 и стабистора VD1с одной из боковых стенок аккумуляторной батареи.

Интегральный регулятор — напряжение

Интегральный регулятор напряжения 9 ( ЯН2А) вместе с щеткодержателем 8 закреплен на алюминиевом кожухе. В отличие от генератора Г222 кожух закреплен не на торцовой, а на боковой поверхности крышки генератора. Натяжное ушко генератора имеет отверстие с резьбой под натяжную планку.

Интегральный регулятор напряжения Я112 — Л.

Интегральный регулятор напряжения проверяют совместно с генератором.

Схемы интегральных регуляторов напряжения типов.

Интегральные регуляторы напряжения встраиваются в генератор, неразборны и ремонту не подлежат.

Интегральный регулятор напряжения Я120АТ генератора Г273А отличается от регулятора ЯИ2Б наличием двух последовательно включенных стабилитронов V5 и V6, числом резисторов с различными значениями сопротивлений. В схеме подключения генераторной установки автомобиля КамАЗ предусмотрены: блокировка дистанционного выключателя массы при работающем генераторе для предохранения полупроводниковых приборов от импульсных перенапряжений, отключение обмотки возбуждения генератора для предупреждения перегорания свечей электрофакельного устройства при пуске двигателя. Массу включают нажатием на кнопку 5 ( рис. 4.11), после чего ток течет в обмотку электромагнита выключателя массы через замкнутые контакты реле 6 электродвигателя отопителя. После перевода выключателя приборов и стартера 4 в положение / подается напряжение через клемму ВК, замкнутые контакты реле S отключения обмотки возбуждения в делитель напряжения и в цепь управления выходных транзисторов.

Схема интегрального регулятора напряжения Я112В.

Малогабаритные интегральные регуляторы напряжения встраиваются в генератор и поэтому в их схеме отсутствуют элементы защиты полупроводниковых элементов.

Схема регулятора напряжения 2.| Схема регулятора напряжения 2 54.

Схема интегрального регулятора напряжения 17.370 2, конструкция которого предусматривает встраивание в него щеточного узла генератора 37.370 1, представлена на рис. 3.16. Регулятор также рассчитан на повышенный ток возбуждения 5 А, поэтому его выходные транзисторы VT4, VT5 включены параллельно.

Схема интегрального регулятора напряжения Я112Б состоит из ряда функциональных каскадов. Измеритель напряжения ( чувствительный каскад) включает в себя стабилитрон FCT с входным делителем напряжения на резисторах Rl, R2, Rper. Резистор Крег служит для настройки регулятора на требуемый уровень напряжения.

Замена неисправного интегрального регулятора напряжения типа Я1 12А или Я1 12В на автомобилях Мос-квич — 2140, ВАЗ-2105 Жигули электрической лампочкой небольшой мощности типа А-12-8 или А1 2 — 5, позволяет временно обеспечивать подзаряд аккумуляторной батареи.

Схема регулятора напряжения 2.| Схема регулятора напряжения 2 54.

По конструкции интегральные регуляторы напряжения представляют собой неразборную конструкцию. Остальные регуляторы разбираются после отворачивания двух или четырех винтов.

В процессе эксплуатации бесконтактные интегральные регуляторы напряжения ( Я112 и Я120) не требуют регулировок и вскрывать их запрещается.

D2092 чем можно заменить

Биполярный транзистор KTD2092 – описание производителя. Основные параметры. Даташиты.

Наименование производителя: KTD2092

Тип материала: Si

Максимальная рассеиваемая мощность (Pc): 25 W

Макcимально допустимое напряжение коллектор-эмиттер (Uce): 80 V

Макcимальный постоянный ток коллектора (Ic): 3 A

Предельная температура PN-перехода (Tj): 175 °C

Статический коэффициент передачи тока (hfe): 500

Корпус транзистора: ISO220

KTD2092 Datasheet (PDF)

SEMICONDUCTOR KTD2092 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR SWITCHING APPLICATION. INTERFACE CIRCUIT AND DRIVER CIRCUIT APPLICATION. A C DIM MILLIMETERS S FEATURES _ A 10.0 0.3 + _ + B 15.0 0.3 E High hFE : hFE=500 1500 (IC=0.5A). C _ 2.70 0.3 + D 0.76+0.09/-0.05 Low Collector Saturation :VCE(sat)=0.35V(Max.) (IC=1A). _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.

5.1. ktd2017.pdf Size:46K _update_mosfet

SMD Type IC SMD Type IC N-Channel Silicon MOSFET KTD2017 TSSOP-8 Unit: mm Features Low ON resistance. 2.5V drive. Mounting height 1.1mm Composite type, facilitating high-density mounting. 5: Gate2 1: Drain1 6 : Source2 2 : Source1 7 : Source2 3 : Source1 8: Drain2 4: Gate1 Absolute Maximum Ratings Ta = 25 Parameter Symbol Rating Unit Drain-to-Source Voltage VDSS 20 V Gate-

5.2. ktd2005.pdf Size:47K _update_mosfet

SMD Type IC SMD Type IC Ultrahigh-Speed Switching Applications KTD2005 TSSOP-8 Unit: mm Features Low ON resistance. 2.5V drive. Mounting height 1.1mm. Composite type, facilitating high-density mounting. 5: Gate2 1: Drain1 6 : Source2 2 : Source1 7 : Source2 3 : Source1 8: Drain2 4: Gate1 Absolute Maximum Ratings Ta = 25 Parameter Symbol Rating Unit Drain-to-Source Voltage V

SEMICONDUCTOR KTD2066 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR HIGH CURRENT SWITCHING APPLICATION. LAMP SOLENO >5.4. ktd2058.pdf Size:40K _kec

SEMICONDUCTOR KTD2058 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S ·Low Saturation Voltage _ A 10.0 0.3 + _ + B 15.0 0.3 E : VCE(sat)=1.0V(Max.) at IC=2A, IB=0.2A. C _ 2.70 0.3 + D 0.76+0.09/-0.05 ·Complementary to KTB1366. _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + H 0.5+0.1/-0.05 _ + J 13.6 0.5

SEMICONDUCTOR KTD2060 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S Good Linearity of hFE. _ A 10.0 0.3 + _ + B 15.0 0.3 E Complementary to KTB1368. C _ 2.70 0.3 + D 0.76+0.09/-0.05 _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + H 0.5+0.1/-0.05 _ + J 13.6 0.5 L L MAXIMUM RATING (Ta=25 ) R K _ 3.7 0.

SEMICONDUCTOR KTD2059 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S Complementary to KTB1367. _ A 10.0 0.3 + _ + B 15.0 0.3 E C _ 2.70 0.3 + D 0.76+0.09/-0.05 _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + MAXIMUM RATING (Ta=25 ) H 0.5+0.1/-0.05 _ + J 13.6 0.5 L L CHARACTERISTIC SYMBOL RATING UNIT R

SEMICONDUCTOR KTD2061 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR HIGH VOLTAGE APPLICATION TV, MONITOR VERTICAL OUTPUT APPLICATION A C DRIVER STAGE APPLICATION DIM MILLIMETERS S COROR TV >5.8. ktd2058.pdf Size:198K _lge

KTD2058(NPN) TO-220 Transistor TO-220 1. BASE 2. COLLECTOTR 3. EMITTER 3 2 1 Features Low Collector Saturation Voltage : VCE(SAT) = 1. 0V(MAX) . Dimensions in inches and (millimeters) MAXIMUM RATINGS (TA=25? unless otherwise noted) Symbol Parameter Value Units VCBO Collector-Base Voltage 60 V VCEO Collector-Emitter Voltage 60 V VEBO Emitter-Base Voltage 7 V IC C

Биполярный транзистор KTD2092 – описание производителя. Основные параметры. Даташиты.

Наименование производителя: KTD2092

Тип материала: Si

Максимальная рассеиваемая мощность (Pc): 25 W

Макcимально допустимое напряжение коллектор-эмиттер (Uce): 80 V

Макcимальный постоянный ток коллектора (Ic): 3 A

Предельная температура PN-перехода (Tj): 175 °C

Статический коэффициент передачи тока (hfe): 500

Корпус транзистора: ISO220

KTD2092 Datasheet (PDF)

SEMICONDUCTOR KTD2092 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR SWITCHING APPLICATION. INTERFACE CIRCUIT AND DRIVER CIRCUIT APPLICATION. A C DIM MILLIMETERS S FEATURES _ A 10.0 0.3 + _ + B 15.0 0.3 E High hFE : hFE=500 1500 (IC=0.5A). C _ 2.70 0.3 + D 0.76+0.09/-0.05 Low Collector Saturation :VCE(sat)=0.35V(Max.) (IC=1A). _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.

5.1. ktd2017.pdf Size:46K _update_mosfet

SMD Type IC SMD Type IC N-Channel Silicon MOSFET KTD2017 TSSOP-8 Unit: mm Features Low ON resistance. 2.5V drive. Mounting height 1.1mm Composite type, facilitating high-density mounting. 5: Gate2 1: Drain1 6 : Source2 2 : Source1 7 : Source2 3 : Source1 8: Drain2 4: Gate1 Absolute Maximum Ratings Ta = 25 Parameter Symbol Rating Unit Drain-to-Source Voltage VDSS 20 V Gate-

5.2. ktd2005.pdf Size:47K _update_mosfet

SMD Type IC SMD Type IC Ultrahigh-Speed Switching Applications KTD2005 TSSOP-8 Unit: mm Features Low ON resistance. 2.5V drive. Mounting height 1.1mm. Composite type, facilitating high-density mounting. 5: Gate2 1: Drain1 6 : Source2 2 : Source1 7 : Source2 3 : Source1 8: Drain2 4: Gate1 Absolute Maximum Ratings Ta = 25 Parameter Symbol Rating Unit Drain-to-Source Voltage V

SEMICONDUCTOR KTD2066 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR HIGH CURRENT SWITCHING APPLICATION. LAMP SOLENO >5.4. ktd2058.pdf Size:40K _kec

SEMICONDUCTOR KTD2058 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S ·Low Saturation Voltage _ A 10.0 0.3 + _ + B 15.0 0.3 E : VCE(sat)=1.0V(Max.) at IC=2A, IB=0.2A. C _ 2.70 0.3 + D 0.76+0.09/-0.05 ·Complementary to KTB1366. _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + H 0.5+0.1/-0.05 _ + J 13.6 0.5

SEMICONDUCTOR KTD2060 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S Good Linearity of hFE. _ A 10.0 0.3 + _ + B 15.0 0.3 E Complementary to KTB1368. C _ 2.70 0.3 + D 0.76+0.09/-0.05 _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + H 0.5+0.1/-0.05 _ + J 13.6 0.5 L L MAXIMUM RATING (Ta=25 ) R K _ 3.7 0.

SEMICONDUCTOR KTD2059 TECHNICAL DATA TRIPLE DIFFUSED NPN TRANSISTOR GENERAL PURPOSE APPLICATION. A C FEATURES DIM MILLIMETERS S Complementary to KTB1367. _ A 10.0 0.3 + _ + B 15.0 0.3 E C _ 2.70 0.3 + D 0.76+0.09/-0.05 _ E Φ3.2 0.2 + _ F 3.0 0.3 + _ 12.0 0.3 G + MAXIMUM RATING (Ta=25 ) H 0.5+0.1/-0.05 _ + J 13.6 0.5 L L CHARACTERISTIC SYMBOL RATING UNIT R

SEMICONDUCTOR KTD2061 TECHNICAL DATA EPITAXIAL PLANAR NPN TRANSISTOR HIGH VOLTAGE APPLICATION TV, MONITOR VERTICAL OUTPUT APPLICATION A C DRIVER STAGE APPLICATION DIM MILLIMETERS S COROR TV >5.8. ktd2058.pdf Size:198K _lge

KTD2058(NPN) TO-220 Transistor TO-220 1. BASE 2. COLLECTOTR 3. EMITTER 3 2 1 Features Low Collector Saturation Voltage : VCE(SAT) = 1. 0V(MAX) . Dimensions in inches and (millimeters) MAXIMUM RATINGS (TA=25? unless otherwise noted) Symbol Parameter Value Units VCBO Collector-Base Voltage 60 V VCEO Collector-Emitter Voltage 60 V VEBO Emitter-Base Voltage 7 V IC C

Замена транзистора 2SC3852

Замена 2SC3852 на отечественный аналог. Довольно часто при ремонте блоков питания телевизоров на микросхемах STR-S6707 (например телевизоры LG, Goldstar) вместе с заменой микросхемы STR-S6707 возникает необходимость замены транзистора 2SC3852 или KSD2092.
Аналогом 2SC3852 и KSD2092, является наш отечественный транзистор КТ829А .

Даташит на 2SC3852

При этом никаких переделок на плате делать не приходится, впаивается вместо неисправного. Единственное на что следует обратить внимание при замене транзистора 2SC3852, он в изолированном корпусе, а транзистор КТ829А – нет. Проверьте радиатор к которому крепится 2SC3852, если он имеет соединение с шиной (минусом), то необходимо поставить изолирующую прокладку.

Прибор ультратоновой терапии

Физиотерапевтические приборы ультратоновой терапии применяются в дерматологии, урологии, неврологии, стоматологии, для лечения хирургических патологий и воспалительных процессов, ЛОР-заболеваний и т.д. Российскими фирмами производятся приборы: Искра-1, Корона, Ультратон, Ультратон АМП-2 и ряд других. Ознакомиться с основами и приборами ультратоновой терапии можно по следующим ссылкам:

Целью при создании данной конструкции было лечение грибкового заболевания- ногтевого грибка на больших пальцах стоп и кожного на локтях рук. Использование антигрибковых мазей, типа Микосептина и ему подобных, показало их полную неэффективность. Мало того, их использование приводило к более интенсивному росту грибка. Просмотр медицинских форумов в Интернете показал, что это отнюдь не случайность, а самая, что ни на есть, закономерность. Врачи на форумах укатываются над лохами, использующими эти мази, не забывая, однако, продолжать их вышеуказанным лохам назначать в соответствии с рекомендациями минздрава и за неимением лучшего. Как показала практика, использование для лечения грибка обыкновенного копеечного йода гораздо эффективней использования дорогих антигрибковых мазей!

Из радиолюбительских разработок, я нашёл единственную публикацию на эту тему: М.Шустов “Аппараты для ультратоновой терапии” Минск,”Радиолюбитель” №7, 1998г., которая и была взята за основу данной конструкции. Основой разработки М.Шустова является блокинг- генератор на базе телевизионного строчного трансформатора, питаемый от регулируемого источника для регулировки амплитуды выходного напряжения (Рис.3):

На схеме VL1- неоновый электрод, в качестве которого используется неоновый цифровой индикатор ИН-12, все электроды которого соединены между собой. Первое, что мне не понравилось- использование редкого ТВС-90ПЦ10. Я 35 лет ремонтирую телевизоры, но не знаю, где стоит такой ТВС! Я сразу поставил цель- использовать ТВС от самых распространённых телевизоров 3УСЦТ- ТВС-110ПЦ15, который можно и всегда купить и найти на ближайщей горсвалке. В процессе отработки схемы на макете выяснилось, что транзистор КТ805АМ сильно греется. Замена его на КТ829А снизила нагрев в несколько раз. Далее, в процессе использования макета для лечения кожного грибка выяснилось, что использование режима мягкого коронного разряда неэффективно, а использование эффективного режима жёсткого искрового разряда тяжело переносится из-за болезненности процедуры. Поэтому М.Шустов предлагает использование импульсного режима (Рис.4):

Отработка на макете показала, что базовая модуляция блокинга на VT2 с помощью транзистора VT1 приводит к падению амплитуды выходного напряжения и увеличению нагрева выходного транзистора VT2. Поэтому я отказался от модуляции по базе и применил модуляцию по коллектору. Использование макета для лечения показало, что импульсный режим при скважности 2 также болезненен, как и непрерывный режим. Тогда я вспомнил, что в приборах электростимуляции очень часто применяются импульсы со скважностью 5. Реализация такого режима модуляции позволила многократно снизить болевые ощущения и сохранить эффективность лечения!

В итоге получилась следующая схема прибора (щелкните мышью для получения большого изображения):

На микросхеме А1 собран регулируемый источник питания блогинг- генератора. Резистором R2 регулируется выходное напряжение прибора. VT1, VT2- модулятор. А2- питание цифровых микросхем. D1, D2- генератор модулирующих импульсов со скважностью 5. Напомню, что скважность- есть отношение периода следования импульсов к их длительности. Резистором R8 регулируется частота модуляции в пределах 10-100 Гц. Тумблером В2 можно включать либо импульсный, либо непрерывный режим работы прибора. Лечебный электрод подключается к высоковольтной обмотке ТВС высоковольтным проводом, в качестве которого можно использовать провода от неисправных умножителей напряжения, центральную жилу от кабелей РК, высоковольтные провода системы зажигания автомобилей. В качестве электродов я использую неоновый индикатор ИН-12, тиратрон МТХ-90 и неоновую лампочку, любую с торцевым направлением излучения. Все выводы неоновых приборов соединены параллельно. Сами неоновые электроды помещены в корпуса, изготовленные из пластмассовых трубок подходящих диаметров с толщиной стенки не менее 3 мм.

Реэультат “клинических” испытаний- при процедуре 3 минуты один раз в сутки, кожный грибок сходит в 3-4 раза быстрее, чем при использовании только йода. После процедуры поражённое место также смазывается йодом. Режим- максимальное напряжение при импульсной модуляции частотой 10 Гц. Следует учитывать, что в режиме жесткого искрового облучения генерируются радиопомехи в широком спектре частот. Позтому пользоваться прибором желательно в наименее смотрибельное телевизионное время!

Прибор пока существует в виде действующего макета. Если будет изготавливаться печатная плата, то статья будет дополнена.

Kt805 datasheet pdf storage

Kt805 datasheet pdf storage

Защитите целостность данных и помогите предотвратить потерю данных с помощью мощной коррекции и. Kt829 datasheet, kt829 pdf, kt829 data sheet, kt829 manual, kt829 pdf, kt829, datenblatt, electronics kt829, alldatasheet, бесплатно, техническое описание, таблицы данных, технические данные. Ktd2026 kec дискретные полупроводники jotrin electronics. Коммутатор ibm system storage san32b3 san обеспечивает 16, 24 или 32 активных порта и предназначен для обеспечения высокой производительности со скоростью соединения 4, 2 и 1 Гбит / с.Инженерное обеспечение соблюдения нормативных требований и защита окружающей среды во всем мире. Модульная дисковая система хранения Ibm system storage n7000. Оптопара, выход на фототранзистор, с базовым подключением. Хранение данных важно для компьютеров во многих отношениях. Kt805 kt610a kt837b bd140 npn kt872a kt837k kt315b kt315 kt818 текст. U a 250 v u g2 250 vu g1 1 v5 i a 100 ma i g2 10 ма s10,5 mav. Etc2, alldatasheet, datasheet, сайт поиска данных для электронных компонентов и полупроводников, интегральных схем, диодов, симисторов и других полупроводников.

Будьте осторожны при обращении с af 3070 fst при низких температурах, поскольку он может легко потрескаться. На этой странице описаны продукты, подходящие для работы с переменным током, и представлены их спецификации. Клиенты несут ответственность за установку блокировки и за обеспечение блокировки своего устройства перед тем, как покинуть объект. Его можно поставить и протестировать в соответствии с требованиями проверки milprf38534 class b и s in. Это устройство разработано для использования в приложениях, требующих хранения и последовательной передачи информации о конфигурации и управлении.Обеспечение качества методы тестирования стратегия тестирования требования к тестам kitron sats тестовое покрытие инструкции по сборке субпоставщик coc aoi xray process. Это предмет мебели, сделанный из деревянных панелей и акцентов из массива дерева. Kt5w2b1116 kt5 датчики контраста переключающий выход pnp, npn переключающее выходное напряжение pnp. Высокое усиление и широкополосные характеристики этого устройства делают его идеальным для применения в усилителях с большим сигналом и общим источником в оборудовании 26-вольтных базовых станций. Данные, вставленные в накопитель me, сундук или порт me io, могут храниться в ячейке из me сети.Любая информация, описанная или содержащаяся в данном документе, может быть изменена без предварительного уведомления в связи с усовершенствованием технологии продукта и т. Д. Тип монтажа система быстрого монтажа тип напряжения переменного тока высота мм 90 ширина мм 18 глубина мм 76 монтажная позиция любая монтажная глубина мм 70 ток для переменного тока номинальное значение 6 характеристика срабатывания класса c напряжение питания. Оптимизированные для видео серверы и решения для хранения данных серии E8. Компания не несет ответственности за товары, утерянные или поврежденные на месте, когда клиент загружает-разгрузку, или за необеспеченные товары на месте i.

Согреть af 3070 fst до условий окружающей среды в герметичной упаковке для предотвращения конденсации влаги на клейкой поверхности. Коммутационная способность коммутационная способность ток для постоянного тока в соотв. Восьмеричный u f 6,3 v i f cca 1,4 типичная характеристика. Функции высокой доступности делают его подходящим для использования в качестве основного коммутатора в средах среднего уровня или в качестве пограничного коммутатора в корпоративных средах, где используется широкий спектр санитарной инфраструктуры. Com – крупнейшая поисковая система по электронным компонентам. Использование облачного сервиса для размещения ваших данных вне офиса вместо обслуживания собственного хранилища данных может повысить эффективность, добавить гибкость, усилить безопасность и сократить расходы за счет сокращения человеческих часов, персонала и инвестиций в оборудование.

Память me 256k – это элемент, добавленный модом extra cells 2. Он может быть поставлен и протестирован в соответствии с требованиями проверки milprf38534 class h. KT103 – это широкополосный семибитный цифровой аттенюатор от Gaas Phemt в герметичном корпусе smt с технологией поверхностного монтажа для высоконадежных приложений. Купите ktd2026 kec, просмотрите производителя и наличие на складе, а также таблицу данных pdf для ktd2026 на jotrin electronics. Ua 250 в ug2 250 в ug1,5 в ia 100 ma ig2 10 ma s 10,5 mav ra 23 k. Этот аттенюатор обеспечивает низкие вносимые потери и превосходную точность затухания.

Marvell оставляет за собой право вносить изменения в этот документ в любое время без предварительного уведомления. Серия n7000 предназначена для предоставления корпоративных систем хранения и управления данными высшего уровня при доступной цене. IBM System Storage серии n7000 Система IBM System Storage серии n7000 предлагает дополнительный выбор организациям, которые сталкиваются с проблемами управления корпоративными данными. Com datasheet поисковый сайт электронных компонентов, полупроводников и других полупроводников. Используя наши расширенные инструменты фильтрации и поиска, вы можете просматривать и сравнивать варианты хранения рядом с вами.Распространенная проблема в лабораториях возникает, когда пыль и грязь накапливаются на линзах подставки микроскопа. Оптопара, выход на фототранзистор, с базовым соединением cqy80n, cqy80ng vishay semiconductors описание Серия cqy80ng состоит из фототранзистора, оптически соединенного с инфракрасным излучающим диодом на основе арсенида галлия в пластиковом двойном корпусе с 6 выводами. Хранилище me 256k может быть отформатировано с помощью Me Performatter. Если вы не можете найти его здесь, больше нигде в мире.

Все содержимое на этой странице представляет собой усиление 19972020 duncan.Последние списки производителей в каталоге становятся мгновенными. Чтобы гарантировать превосходный однородный цвет, каждая дверь собирается и. Ячейка для хранения пятого уровня может вместить 32 512 стопок одного предмета или 16 640 стопок 63 различных предметов. Kt805 datasheetpdf список неклассифицированных производителей. Выходная мощность с турбонаддувом и наддувом, расход топлива. Fuji Electric предлагает обширную линейку микросхем управления питанием. Kt805 техническое описание, перекрестные ссылки, схемы и примечания по применению в формате pdf. Техническое описание pure storage flasharrayx ускоряет работу основных приложений и предоставляет современные возможности обработки данных.Чистое хранилище flasharrayx, первый в мире, полностью состоящий из флэш-накопителей nvme и nvmeof array, теперь дополнительно включает в себя расширение памяти класса хранилища для удовлетворения самых высоких требований к производительности корпоративных приложений. Ленточный накопитель storagetek lto8 перемещает данные без сжатия со скоростью до 360 мегабайт в секунду. На следующем рисунке показано хранилище lenovo n3310. Обеспечивает хранилище объемом 2 петабайта с занимаемой площадью всего 20 микрон. Некоторые из первых компьютеров даже требовали наличия карточек.

Галлон-час Полная выходная мощность двигателя, кВт · м Рабочий объем литро-час. Расстояние срабатывания 40 мм Рекомендуемые аксессуары другие модели и. Kt805am – параметры, поиск аналогов. Kt805 datasheet, kt805 pdf, kt805 data sheet, kt805 manual, kt805 pdf, kt805, datenblatt, electronics kt805, alldatasheet, free, datasheet, datasheets, data sheet. Техническое описание транзистора kt838a, pdf, эквивалент kt838a. Самая ранняя форма хранения данных заключалась в использовании карт с пробитыми в них отверстиями. Обозначения, выделенные жирным шрифтом, близки или идентичны, курсивом обозначены разные номиналы, разные выводы или разные напряжения накала.KT109 – это широкополосный семибитный цифровой аттенюатор gaas phemt с параллельным управлением в герметичном корпусе smt с технологией поверхностного монтажа для высоконадежных приложений. Kt5w2n1116 kt5 датчики контраста, расстояние срабатывания, расстояние срабатывания устанавливается в% 10 0. Fl817c datasheet, 4-контактный DIP-оптрон fangjing, fl817c pdf, fl817c распиновка, эквивалент, данные fl817c, схема fl817c, выход fl817c, ic, схема. Kt805bm datasheet, kt805bm pdf, kt805bm data sheet, kt805bm manual, kt805bm pdf, kt805bm, datenblatt, electronics kt805bm, alldatasheet, бесплатно, техническое описание, таблицы данных.ВЧ силовые полевые транзисторы nchannelhancementmode lateral mosfet, предназначенные для широкополосных коммерческих и промышленных приложений с частотами от 865 до 895 МГц. Kt838a – параметры поиска по каталогам.

Kt805 техническое описание pdf, kt805 техническое описание, kt805, kt805. Отрежьте часть пленки, которая будет использоваться, от рулона с установленной защитной пленкой. Это отличный выбор для вашего бизнеса, независимо от того, впервые ли вы используете сетевое хранилище NAS или развертываете передовые решения для хранения данных.Технический паспорт продукта 5sy41067 аналогичный изображению автоматический выключатель 230400в 10ка, 1полюс, c, 6a, d70мм технические данные. Af 3070 fst Вводный технический паспорт, страница 3 из 3 При нанесении пленки следует проявлять осторожность, чтобы избежать загрязнения клея и очищенного или загрунтованного алюминия любыми веществами, которые будут препятствовать смачиванию клея. Kt805 kt610a kt837b bd140 npn kt872a kt837k kt315b kt315 kt818. Концепции деревянного шкафа с 4 полками идеально подходят для использования в качестве кладовой на кухне или в офисе, прачечной, спальне, гараже или любой комнате, где необходимы дополнительные скрытые хранилища.Пожалуйста, смотрите заменители вверху страницы для получения более подробной информации.

Благодаря технологиям трансформации mc1221w ESD защитный чехол для микроскопа вы можете защитить оптику вашего микроскопа от пыли и других загрязнений, сохраняя при этом безопасность вашей рабочей станции от электростатического разряда. Yx805 datasheet pdf, yx805 pdf datasheet, эквивалент, схема, yx805 datasheets, yx805 wiki, транзистор, перекрестная ссылка, скачать pdf, сайт бесплатного поиска, распиновка. Электромагнитная совместимость2 продукт был сертифицирован и отмечен знаком, в зависимости от обстоятельств, властей EMC, как указано ниже.Цена единицы хранения основана на нескольких факторах, в том числе на удобствах объекта, таких как доступ 247, бесплатное использование грузовика, удобствах единиц хранения, таких как климат-контроль, электрическая розетка, расположение объекта, расположение блока, которое будет иметь единица на первом этаже. Затем их можно было загрузить в компьютер, когда они были необходимы, и данные могли быть обработаны. Fibrenetix e8series поставляется в стандартном стоечном форм-факторе 3u 19, предлагая емкость хранения до 128 ТБ с возможностью добавления до 4. Техническое описание Ss8050d, перекрестные ссылки, схемы и примечания по применению в формате PDF.Техническое описание Никакая часть этого документа не может быть воспроизведена или передана в любой форме и любыми средствами, электронными или механическими, включая фотокопирование и запись, для любых целей без явного письменного разрешения Marvell.

Опосредованная малой РНК петля отрицательной обратной связи контролирует динамику восприятия кворума у ​​Vibrio harveyi

Abstract

Биолюминесцентная морская бактерия Vibrio harveyi использует процесс межклеточной коммуникации, называемый кворум-зондированием (QS), для совместной работы. поведение ординат в ответ на изменение плотности населения.QS достигается за счет секреции и обнаружения внеклеточных сигнальных молекул, называемых аутоиндукторами. В центре цепи QS V. harveyi находятся пять малых регуляторных РНК, называемых Qrr1-5, которые дестабилизируют мРНК luxR , кодирующей LuxR, главный регулятор транскрипции генов-мишеней QS. Здесь мы показываем, что LuxR напрямую активирует транскрипцию qrr 2, qrr 3 и qrr 4, что приводит к быстрому подавлению активности luxR .Сайты связывания LuxR в промоторах qrr 2, qrr 3 и qrr 4 были идентифицированы и мутированы для определения последствий этой регуляторной петли на динамике QS. Разрыв петли задерживает переход от высокой плотности клеток к низкой и, что более важно, снижает плотность клеток, при которой популяция достигает кворума. Наши результаты показывают, что обратная связь важна для оптимизации динамики переходов между индивидуальным и групповым поведением.

Введение

Бактерии реагируют на колебания в окружающей их среде, связывая внешнюю сенсорную информацию с соответствующими изменениями поведения. Регуляторные сети, которые настраивают бактерии на окружающую среду, обычно передают информацию факторам транскрипции, которые контролируют определенные наборы генов в ответ на определенные стимулы. Регуляторные сети построены из повторяющихся единиц, называемых сетевыми мотивами, которые выполняют определенные этапы обработки информации (Hartwell et al ., 1999; Алон, 2007). Часто дополнительные функции, наложенные на эти биологические сети, точно контролируют динамику сенсорного реле и повышают его надежность. Например, петли положительной обратной связи могут способствовать быстрым переходам между отдельными стабильными состояниями, в то время как петли отрицательной обратной связи могут ускорять время реакции и уменьшать межклеточную изменчивость (Ferrell, 2002; Rosenfeld et al ., 2002). Интеграция сенсорной информации необходима для бактериальной адаптации; таким образом, экологическая ниша организма, вероятно, движет эволюцией оптимизированных сетевых архитектур.

Одним из изменяющихся параметров окружающей среды, за которым следят бактерии, является плотность популяции клеток, и это достигается за счет определения кворума (QS). QS – это механизм химической коммуникации, который позволяет бактериям отслеживать плотность популяции, секретируя и обнаруживая внеклеточные сигнальные молекулы, называемые аутоиндукторами (AI) (Waters and Bassler, 2005). Бактерии QS контролируют концентрацию AI как показатель количества клеток. В ответ на накопление ИИ популяции бактерий координированно изменяют экспрессию больших наборов генов для выполнения задач, которые предположительно являются продуктивными только тогда, когда группы клеток действуют согласованно.

В биолюминесцентной морской бактерии Vibrio harveyi QS контролирует такие процессы, как биолюминесценция, секреция типа III, производство и метаболизм циклических ди-GMP (Fuqua et al. ., 1994; Miller and Bassler, 2001; Henke and Bassler, , 2004; Waters and Bassler, 2006; Waters et al ., 2008) (подробнее см.). V. harveyi синтезирует три AI. HAI-1, N – (β-гидроксибутирил) гомосериновый лактон, который является наиболее сильным из трех сигналов, представляет собой видоспецифический AI, продуцируемый LuxM-синтазой (Cao and Meighen, 1989; Bassler et al ., 1993). CAI-1 ( S ) -3-гидрокситридекан-4-он представляет собой специфичный для рода сигнал, который продуцируется CqsA-синтазой (Miller et al ., 2002; Higgins et al ., 2007). Третий AI, AI-2 (2 S , 4 S ) -2-метил-2,3,3,4-тетрагидрокситетрагидрофуранборат, представляет собой межвидовой сигнал, продуцируемый LuxS-синтазой (Bassler et al ., 1997; Шаудер и др. ., 2001; Чен и др. ., 2002). Каждый из трех AI обнаруживается родственным мембраносвязанным двухкомпонентным датчиком гистидинкиназы: HAI-1 связывается с LuxN (Bassler et al ., 1993; Freeman et al ., 2000), CAI-1 связывается с CqsS (Miller et al ., 2002), а AI-2 распознается LuxQ в сочетании с периплазматическим белком LuxP (Bassler et al ., 1994; Neiditch et al ., 2005; 2006).

Модель V. harveyi Quorum-Sensing Circuit. V. harveyi продуцирует и обнаруживает три AI и посредством модуляции уровней главного регулятора транскрипции, LuxR, контролирует расположенные ниже гены-мишени QS.Три AI: CAI-1 (кружки), который связывается с CqsS, HAI-1 (пятиугольники), который связывается с LuxN, и AI-2 (двойные пятиугольники), который связывается с LuxPQ. В LCD, когда LuxO фосфорилируется (LuxO˜P), он активирует транскрипцию генов, кодирующих пять мРНК Qrr, которые работают вместе с Hfq, дестабилизируя мРНК luxR . В HCD, когда LuxO не фосфорилируется, транскрипция qrr прекращается, мРНК luxR стабилизируется и продуцируется белок LuxR. В петле обратной связи LuxR активирует экспрессию qrr 2, qrr 3 и qrr 4, что влияет на синхронизацию QS-переходов.ОМ, наружная мембрана; IM, внутренняя мембрана.

При незначительных концентрациях AI, то есть при низкой плотности клеток (LCD), три сенсора действуют как киназы, которые переносят фосфат через LuxU в LuxO (Freeman and Bassler, 1999a, b; Lilley and Bassler, 2000). LuxO˜P активирует экспрессию генов, кодирующих пять высококонсервативных малых регуляторных РНК (мРНК), называемых Qrr1–5 (Tu and Bassler, 2007). Qrrs соединяется с 5′-UTR мРНК luxR и дестабилизирует ее, процесс, который требует шаперона РНК Hfq (Lenz et al ., 2004). LuxR является главным регулятором транскрипции генов QS в V. harveyi (Showalter et al ., 1990; Swartzman et al ., 1992). Таким образом, на ЖК-дисплее, когда присутствует мало LuxR, QS отсутствует, и клеток V. harveyi действуют как индивидуумы. При высокой плотности клеток (HCD) ИИ накапливаются и связываются со своими родственными сенсорами. Это событие заставляет сенсоры действовать как фосфатазы, что приводит к дефосфорилированию LuxO. Нефосфорилированный LuxO неактивен. Транскрипция генов, кодирующих мРНК, прекращается, вызывая накопление мРНК luxR (Freeman and Bassler, 1999b; Lilley and Bassler, 2000).Недавно произведенный белок LuxR активирует и репрессирует многочисленные гены. В частности, LuxR активирует оперон luxCDABE , кодирующий люциферазу, которая необходима для биолюминесценции (Miyamoto et al ., 1994). Таким образом, при HCD инициируется QS, и клеток V. harveyi действуют как группа.

Большинство регулирующих компонентов схемы QS были определены в V. harveyi , что позволяет нам приступить к анализу функций сети передачи сигналов QS, которые оптимизируют В.harveyi способен реагировать на различные условия сообщества. Здесь мы сообщаем об обнаружении петли отрицательной обратной связи в регуляторном каскаде QS V. harveyi с участием LuxR и Qrr мРНК. Мы показываем, что LuxR напрямую связывается и активирует транскрипцию промоторов, предшествующих qrr 2, qrr 3 и qrr 4, но не qrr 1 или qrr 5. Это приводит к повышенной дестабилизации luxR мРНК и подавление продукции LuxR.Мутация консенсусных сайтов связывания LuxR в промоторах V. harveyi qrr 2, qrr 3 и qrr 4 нарушает петлю отрицательной обратной связи и влияет на время перехода из режима HCD в режим LCD и наоборот. У близкородственного вида Vibrio cholerae мы ранее охарактеризовали петлю отрицательной обратной связи, состоящую из HapR (гомолог LuxR) и мРНК V. cholerae Qrr (Svenningsen et al ., 2008). Однако в г.cholerae , механизм, с помощью которого HapR осуществляет обратную связь для активации экспрессии qrr , отличается от V. harveyi . Вместе наши исследования показывают, что LuxR / HapR-sRNA-опосредованная отрицательная обратная связь важна для оптимизации динамики переходов между индивидуальным и групповым поведением у Vibrios .

Результаты

LuxR связывается с промоторами

qrr2 , qrr3 и qrr4

HapR, V.cholerae , гомолог V. harveyi LuxR, активирует экспрессию генов V. cholerae qrr посредством непрямого механизма (т.е.HapR не связывает промоторы qrr напрямую). Петля обратной связи, опосредованная HapR-sRNA, работает только во время перехода HCD в LCD, когда присутствуют и HapR, и LuxO˜P, и при этом она ускоряет переход V. cholerae из социального режима в индивидуальный. сотовый режим (Svenningsen et al ., 2008). Поскольку мы не знаем идентичности компонента, связывающего HapR с генами qrr , мы смогли изучить поведение QS только в штаммах V. cholerae , которые являются HapR + или HapR , но не в штаммы HapR + с устраненной петлей отрицательной обратной связи. V. cholerae и V. harveyi тесно связаны и имеют похожие, но не идентичные схемы QS, поэтому мы задались вопросом, имеет ли V. harveyi аналогичную петлю обратной связи, в которой LuxR активирует В.harveyi qrr генов. Если это так, мы предположили, что можем использовать различия между цепями QS V. harveyi и V. cholerae QS, чтобы лучше понять роль этой петли обратной связи.

Чтобы проверить различия между петлями обратной связи V. harveyi и V. cholerae , мы провели анализ сдвига подвижности геля с очищенным белком LuxR и вышележащими промоторными областями qrr 1–5, чтобы определить, может ли LuxR связываться им.LuxR напрямую связывается с промоторами qrr 2, qrr 3 и qrr 4, но не с промоторами qrr 1 или qrr 5 (). Изучение паттернов связывания предполагает, что in vitro , LuxR имеет наивысшее сродство к промотору qrr 4, за ним следует qrr 2 и затем qrr 3. В соответствии с этими результатами консенсусный сайт связывания LuxR , TATTGATAAATTTATCAATAA (Pompeani et al ., 2008), присутствует в промоторах qrr 2, qrr 3 и qrr 4, но отсутствует в промоторах qrr 1 и qrr 5 ().Мы мутировали консенсусный сайт связывания в qrr 2, qrr 3 и qrr 4 путем рандомизации области при сохранении исходного содержания A / T и G / C, которое мы называем qrr 2 luxR-bs , qrr 3 luxR-bs и qrr 4 luxR-bs , и это устранило привязку LuxR ().

LuxR и HapR связываются с промоторами V. harveyi qrr 2, qrr 3 и qrr 4

A. Анализ сдвига подвижности геля связывания LuxR с V.harveyi qrr WT промоторов и мутантных промоторов qrr 2, qrr 3 и qrr 4 (обозначенных qrr luxR-bs ), лишенных сайта связывания LuxR. Зонд длиной 10 нм использовали со следующими концентрациями очищенного белка LuxR (нМ) (слева направо): 0, 6,25, 31,25, 62,5, 125. B. Промоторные области показаны для пяти генов V. harveyi qrr . Консенсусные сайты связывания LuxR (крайние левые черные ящики) в qrr 2, qrr 3 и qrr 4 изображены относительно сайтов связывания LuxO (крайние правые черные ящики).C. Сдвиги подвижности геля для связывания HapR с промоторами V. harveyi qrr WT и мутантными промоторами qrr 2, qrr 3 и qrr 4 (обозначены qrr luxR-bs ) отсутствует сайт связывания LuxR. Зонд длиной 10 нм использовался со следующими концентрациями очищенного белка HapR (нМ) (слева направо): 0, 25, 125, 250 500.

LuxR и HapR принадлежат к семейству регуляторов транскрипции TetR, которые имеют сходную ДНК. -обвязка сайтов распознавания.Важно отметить, что указанный выше консенсусный сайт связывания отсутствует во всех промоторах qrr V. cholerae, что согласуется с нашими более ранними данными о том, что в V. cholerae регуляция HapR транскрипции qrr является непрямой. Мы задавались вопросом, может ли HapR, будучи неспособным связываться с промоторами qrr V. cholerae , связываться с промоторами qrr V. harveyi 2, qrr 3 и qrr 4, поскольку LuxR и HapR имеют 88% идентичность последовательностей. в ДНК-связывающем домене и 70% идентичности последовательности в общей последовательности белка.Анализ сдвига геля () показывает, что, как и V. harveyi LuxR, HapR связывает промоторы qrr 2, qrr 3 и qrr 4 с наивысшим сродством к qrr 4, за которым следует qrr 2, и HapR демонстрирует слабое сродство к qrr 3 (). Для наблюдения связывания требовались более высокие концентрации белка HapR, чем белка LuxR. Однако HapR не сдвигал промоторы qrr 2, qrr 3 и qrr 4, когда сайт связывания LuxR-консенсуса был мутирован, показывая, что белок HapR специфически связывается с сайтом связывания LuxR.

LuxR достаточно для активации транскрипции

qrr2 , qrr3 и qrr4 в Escherichia coli

LuxO˜P абсолютно необходим для экспрессии гена qrr (Lenz et al ., 2004). Учитывая результаты, мы задались вопросом, ответственны ли только LuxR и LuxO˜P за транскрипционный контроль генов qrr или другие факторы участвуют в их регуляции. Чтобы исследовать это, мы ввели конститутивно активный мутантный аллель luxO , который имитирует LuxO˜P, в хромосому E.coli на сайте λ att . Мы также ввели в этот штамм две плазмиды: одна плазмида содержит luxR под своим нативным промотором, а вторая плазмида содержит транскрипционное слияние gfp с каждым из промоторов qrr V. harveyi. Для каждого слияния qrr-gfp мы ввели конструкции, несущие консенсус-связывающий сайт LuxR дикого типа (WT) или мутированный сайт. показывает, что в присутствии LuxO˜P транскрипция qrr 2, qrr 3 и qrr 4 активируется LuxR в E.coli , тогда как qrr 1 и qrr 5 не показывают увеличения экспрессии в присутствии LuxR. Опять же, эти результаты подтверждаются биоинформатикой и анализами сдвига подвижности геля в. В случае слияния qrr-gfp , несущих мутированные сайты связывания LuxR, LuxR-зависимая активация экспрессии снижается для qrr 2 ( qrr 2 luxR-bs ) и устраняется для qrr 3 и qrr 4 ( qrr 3 luxR-bs и qrr 4 luxR-bs ).Анализы сдвига в геле предполагают, что LuxR не может связываться с мутантным промотором qrr 2 in vitro ; однако эксперимент предполагает, что, по-видимому, остается умеренный эффект LuxR in vivo . Это может быть связано с различиями в архитектуре in vitro, и in vivo, промотора qrr 2, который позволяет LuxR связывать in vivo . Вместе эти данные показывают, что в присутствии LuxO˜P LuxR напрямую активирует экспрессию qrr 2, qrr 3 и qrr 4, и требуется предсказанный сайт связывания LuxR.Эти результаты резко контрастируют с нашими результатами с V. cholerae , где HapR регулирует экспрессию qrr только с помощью дополнительного неизвестного фактора, и не происходит активации экспрессии qrr в E. coli , несущих HapR и LuxO˜. P (Svenningsen et al ., 2008).

LuxR напрямую активирует транскрипцию qrr 2, qrr 3 и qrr 4 в E. coli . Конститутивно активный аллель luxO , luxO D47E, был рекомбинирован на хромосоме E.coli , штамм MC4100 на участке λ att . Проточную цитометрию использовали для измерения продукции флуоресценции (в произвольных единицах) WT слияния промотор V. harveyi qrr gfp и промоторов qrr с мутированными сайтами связывания LuxR ( qrr luxR-bs ) . Измерения проводились в присутствии и в отсутствие LuxR. штаммы E. coli : KT1646 ( qrr 1- gfp ), KT1648 ( qrr 1- gfp + luxR ), KT1529 ( qrr 2- gfp ), KT1530 ( qrr 2- gfp + luxR ), KT1535 ( qrr 2 luxR-bs gfp ), KT1536 ( qrr 2 luxR-bs gfp + luxR ) , KT1531 ( qrr 3- gfp ), KT1532 ( qrr 3- gfp + luxR ), KT1614 ( qrr 3 luxR-bs gfp ), KT1615 ( qrr ), KT1615 3 luxR-bs gfp + luxR ), KT1533 ( qrr 4- gfp ), KT1534 ( qrr 4- gfp + luxR ), KT1539 ( qrr ) 4 luxR-bs gfp ), KT1540 ( qrr 4 luxR-bs gfp + luxR ), KT1647 ( qrr 5- gfp 9 0026), KT1649 ( qrr 5- gfp + luxR ).Фоновую флуоресценцию измеряли в отсутствие LuxO˜P, которая составляла в среднем около 20 единиц (данные не показаны). Культуры выращивали в трех экземплярах, и столбцы ошибок обозначают стандартное отклонение среднего значения.

Удаление

luxR и сайтов связывания LuxR в qrr2 , qrr3 и qrr4 снижает экспрессию qrr в V. harveyi

Приведенные выше результаты устанавливают прямую связь между LuxR и qrr 2 , qrr 3 и qrr 4 выражения.Чтобы определить, активирует ли LuxR, как и в случае E. coli , экспрессию qrr в V. harveyi , мы измерили уровни Qrr на LCD и HCD, используя количественную ПЦР в реальном времени в WT V. harveyi , a Δ штамм luxR и штамм, в которых три сайта связывания LuxR в промоторах qrr были мутированы ( qrr 2,3,4 luxR-bs ). Наши результаты показаны в. Каждая расшифровка Qrr нормализуется до соответствующего уровня в WT на ЖК-дисплее.Во-первых, по сравнению с WT V. harveyi на ЖК-дисплее, уровни Qrr резко снижаются в WT V. harveyi на HCD (черные полосы). Этот результат согласуется с нашей моделью, в которой гены qrr максимально экспрессируются на LCD, когда LuxO˜P в большом количестве, и они минимально экспрессируются на HCD, когда LuxO не фосфорилирован [(Lenz et al ., 2004; Tu и Басслер, 2007)]. Во-вторых, на ЖК-дисплее уровни Qrr2, Qrr3 и Qrr4 значительно снижаются в штаммах Δ luxR и qrr 2,3,4 luxR-bs по сравнению с WT (белые полосы и серые полосы соответственно).В-третьих, при HCD уровни Qrr3 и Qrr4 у этих мутантных штаммов снижаются еще больше. Эти два последних результата подтверждают, что LuxR осуществляет обратную связь для активации экспрессии qrr 2, qrr 3 и qrr 4 in vivo , потому что в отсутствие LuxR или в штамме V. harveyi , в котором LuxR -связывающие сайты были удалены из промоторов qrr , экспрессия qrr снижается. Мы отмечаем, что это также подтверждает, что qrr 1, хотя и контролируется плотностью клеток, не активируется LuxR in vivo , и, кроме того, что qrr 5 не подлежит контролю плотности клеток или регуляции обратной связи LuxR-Qrr, потому что Qrr5 уровни примерно одинаковы во всех исследованных штаммах.Этот последний момент согласуется с нашими предыдущими исследованиями, демонстрирующими, что QS не контролирует экспрессию qrr 5 (Tu and Bassler, 2007).

LuxR активирует экспрессию qrr 2, qrr 3 и qrr 4 в V. harveyi . РНК выделяли из BB120 (WT; черные столбцы), KM669 (Δ luxR ; белые столбцы) и KT551 ( qrr 2,3,4 luxR-bs ; серые столбцы) на ЖК-дисплее (OD 600 ˜ 0,025) и HCD (OD 600 -1,5).Уровни Qrr измеряли с помощью количественной ПЦР в реальном времени. Измерения были нормализованы к значениям WT на ЖК-дисплее, и на графике нанесены кратные различия. Каждый образец анализировали в четырех повторностях, и столбцы ошибок обозначают стандартное отклонение среднего значения.

Цепь обратной связи LuxR-мРНК ускоряет переход от HCD к LCD

Чтобы проверить, когда работает петля обратной связи V. harveyi , мы измерили уровни мРНК Qrr4 и luxR во время перехода от HCD к LCD в WT V. .harveyi и сравнил их со штаммом V. harveyi без петли обратной связи. В этом последнем штамме мы мутировали сайты связывания LuxR в промоторах qrr 2, qrr 3 и qrr 4 ( qrr 2,3,4 luxR-bs ), чтобы отключить петлю обратной связи. . Мы также сравнили уровни Qrr4 у этих двух штаммов на фоне Δ luxR . Кроме того, во всех штаммах мы удалили luxM и luxS , кодирующие синтазы AI, и использовали добавление очищенных AI для точного контроля состояний HCD и LCD.Все штаммы выращивали в присутствии насыщающих AI, а затем культуры промывали и ресуспендировали в свежей среде без AI, чтобы имитировать немедленный переход от HCD к LCD. показывает Нозерн-блоттинг уровней мРНК Qrr4 и luxR в течение периода сразу после отмывки в среде без AI. На верхней панели показано, что у штаммов WT и qrr 2,3,4 luxR-bs уровни Qrr4 быстро увеличиваются после перехода от HCD к LCD; однако штамм WT обладает больше Qrr4, чем штамм, лишенный петли обратной связи LuxR-sRNA во все моменты времени (сравните дорожки 1-5 с 6-10).Количественная оценка интенсивности сигналов транскрипта Qrr4 показывает, что сразу после перехода HCD в LCD Qrr4 накапливается в WT в два раза быстрее, чем в штамме, лишенном петли обратной связи LuxR-sRNA. Примерно через 10 минут в свежей среде уровни Qrr4 в штамме, лишенном петли обратной связи, действительно накапливаются почти до уровней WT. На средней панели показано, что после удаления AI транскрипт luxR разлагается быстрее в штамме WT, чем в штамме без петли обратной связи.В частности, период полужизни мРНК luxR составляет ~ 2 мин в штамме WT и ~ 4 мин в штамме без петли обратной связи. Вместе эти результаты показывают, что инактивация петли обратной связи LuxR-sRNA задерживает, но не отменяет, переход V. harveyi из социального режима в индивидуальный клеточный режим. Дорожки 11–20 на верхней панели показывают, что уровни Qrr4 дополнительно снижаются у обоих тестовых штаммов, когда им не хватает luxR . Этот результат предполагает, что дополнительные факторы могут действовать через LuxR, регулируя экспрессию qrr в V.Харвей .

Петля обратной связи LuxR-sRNA влияет на переход HCD в LCD. V. harveyi штаммов KT794 (Δ luxM , Δ luxS ), KT797 (Δ luxM , Δ luxS , qrr 2,3,4 luxR-bs ), KT827 (Δ luxM , Δ luxS , luxR :: Kan) и KT829 (Δ luxM , Δ luxS , qrr 2,3,4 luxR-bs , luxR :: Kan) были выросла до OD 600 −1.5 в присутствии насыщающих AI (5 мкМ каждого HAI-1 и AI-2), а затем промывали и ресуспендировали в свежей среде для имитации перехода от HCD к ЖК-дисплею. РНК выделяли в указанные сроки после отмывки, и мРНК Qrr4 и luxR анализировали с помощью Нозерн-анализа. 5S РНК показана в качестве контроля загрузки, и интенсивности полос для мРНК luxR были количественно определены и нормализованы к 5S РНК. Эксперимент проводился дважды.

Петля обратной связи LuxR-sRNA действует при переходе от LCD к HCD.

показывает, что в отсутствие петли обратной связи LuxR-sRNA уровни Qrr2, Qrr3 и Qrr4 снижаются при HCD по сравнению с WT.Учитывая, что Qrr мРНК максимально продуцируются на LCD, мы задавались вопросом, может ли снижение уровней Qrr в HCD способствовать увеличению продукции LuxR, что, в свою очередь, может повлиять на время экспрессии гена-мишени HCD. Чтобы проверить это, мы сконструировали штаммы, которые являются WT для петли обратной связи, которые несут единственную мутацию qrr luxR-bs , так что петля обратной связи функционирует на двух генах qrr , но не на третьем (их три мутанты: qrr 2 luxR-bs и qrr 3 luxR-bs и qrr 4 luxR-bs ) и тройной qrr 2,3,4 luxR-bs мутант в котором полностью устранена петля обратной связи.Мы также сконструировали мутации в этих штаммах, чтобы они реагировали исключительно на экзогенно поставляемые AI, удаляя luxM и luxS . Мы также удалили ген cqsS , чтобы устранить ответ на CAI-1. Используя биолюминесценцию в качестве показаний, мы измерили ответ каждого штамма на возрастающие концентрации AI (). Половина максимальной эффективной концентрации AI для WT V. harveyi составляет 19 нМ. Одиночные мутанты qrr luxR-bs реагируют на несколько более низкие уровни AI ( qrr 2 luxR-bs = 13 нМ, qrr 3 luxR-bs = 16 нМ и qrr 4 luxR -bs = 13 нМ).Тройной мутант qrr 2,3,4 luxR-bs отвечает на значительно более низкий AI, 4 нМ, демонстрируя, что штамм, лишенный петли обратной связи LuxR-sRNA, в пять раз более чувствителен к AI, чем WT. Следовательно, обратная связь LuxR-sRNA действительно контролирует переход LCD в HCD, предотвращая преждевременный переход V. harveyi в состояние HCD и неправильную экспрессию генов, необходимых для социального поведения. Важно отметить, что все штаммы, использованные в эксперименте, представляют собой AI и, таким образом, не продуцируют LuxR до тех пор, пока не будет добавлен экзогенный AI.Это показывает, что петля отрицательной обратной связи LuxR-sRNA влияет на белок LuxR, который синтезируется в ответ на AI.

Петля обратной связи LuxR-sRNA влияет на переход LCD в HCD. Следующие штаммы были протестированы на их реакцию на различные концентрации AI с использованием светового потока в качестве считывания: TL27 (Δ luxM , Δ luxS , Δ cqsS ; черные квадраты), KT773 (TL27, qrr 2 luxR-bs ; синие ромбы), KT770 (TL27, qrr 3 luxR-bs ; зеленые треугольники), KT767 (TL27, qrr 4 luxR-bs ; фиолетовые треугольники), KT819 (TL27, qrr 2,3,4 luxR-bs ; красные кружки).Данные были сопоставлены с сигмоидальной кривой доза-ответ с переменным наклоном, чтобы определить концентрацию полумаксимального ответа для каждого штамма. RLU – отсчеты мин. −1 мл −1 / OD 600 .

Нарушение петли обратной связи LuxR-Qrr влияет на динамику восприятия кворумом

Одним из важнейших аспектов настоящего исследования, который отличает его от более раннего исследования V. cholerae , является то, что мы можем вырезать петлю обратной связи, опосредованную LuxR-sRNA и исследовать последствия для последующего поведения QS.Для этого мы сконструировали штаммов V. harveyi , в которых только один сайт связывания LuxR предшествует qrr 2, qrr 3 или qrr 4 ( qrr 2 luxR-bs или qrr 3 luxR-bs или qrr 4 luxR-bs ) были мутированы. Мы создали двойной мутант qrr 2,4 luxR-bs и тройной мутантный штамм, в котором три сайта связывания LuxR были отменены ( qrr 2,3,4 luxR-bs ).Эта стратегия позволила нам частично или полностью устранить петлю отрицательной обратной связи, сохранив при этом оставшуюся часть схемы QS нетронутой. Мы измерили биолюминесценцию как результат поведения QS.

В WT V. harveyi экспрессия биолюминесценции демонстрирует характерный QS-регулируемый паттерн (белые квадраты): после разведения в течение ночи культуры HCD светопродукция на клетку резко снижается. Это снижение биолюминесценции происходит из-за разбавления AI ниже уровня, необходимого для активации экспрессии люкс .Однако по мере роста культуры эндогенно продуцируемые ИИ увеличиваются до тех пор, пока не будет достигнут критический порог ИИ, и снова начнется производство света. Когда мутирует только один из трех сайтов связывания LuxR в генах qrr , V. harveyi демонстрирует умеренно более высокое светопродукцию, чем WT при переходе от ЖК-дисплея к HCD, с qrr 4 luxR-bs . мутант, демонстрирующий наибольшее увеличение светового потока (закрашенные кружки), за ним следует мутант qrr 2 luxR-bs (закрашенные ромбики) и, наконец, мутант qrr 3 luxR-bs (закрашенные треугольники) .Кроме того, переход происходит раньше у мутантов, чем у штамма WT, что указывает на то, что мутантные штаммы реагируют на более низкие концентрации AI. Этот паттерн аналогичен паттерну аффинности связывания LuxR с каждым промотором qrr (). В двойном мутанте qrr 2,4 luxR-bs , V. harveyi показывает большее увеличение биолюминесценции и более ранний переход, чем в любом из одиночных мутантов qrr luxR-bs (, закрашенные квадраты ).Наконец, при полном отсутствии петли отрицательной обратной связи LuxR-sRNA ( qrr 2,3,4 luxR-bs тройной мутант) мы наблюдаем наиболее драматический эффект, поскольку штамм демонстрирует примерно 10-кратное увеличение биолюминесценция и самый ранний переход из режима LCD в QS (, светлые кружки). Таким образом, переход к HCD происходит с нарастающей скоростью у мутантов, которые все в большей степени нарушают работу петли обратной связи LuxR-sRNA.

Петля обратной связи LuxR-мРНК влияет на динамику QS

Биолюминесценция, зависящая от плотности, была измерена в следующих В.harveyi штаммы: BB120 (WT, белые квадраты), KT383 ( qrr 2 luxR-bs ; закрашенные ромбики), KT613 ( qrr 3 luxR-bs ; закрашенные треугольники), KT311 ( qrr 4 luxR-bs ; закрашенные кружки), KT523 ( qrr 2,4 luxR-bs ; закрашенные квадраты), KT551 ( qrr 2,3,4 luxR-bs ; белые кружки). RLU – отсчеты мин. −1 мл −1 / OD 600 .

Чтобы понять вклад отдельных LuxR-Qrr-опосредованных петель обратной связи в QS-переход, мы построили В.harveyi , несущие одну конкретную инактивирующую мутацию промотора qrr luxR-bs в штамме, несущем только этот конкретный неповрежденный qrr . Наше обоснование состояло в том, чтобы изучить, как функционирует петля обратной связи в присутствии нескольких, а не только одной Qrr sRNA (). Для сравнения мы показываем поведение WT V. harveyi (то есть присутствуют все мРНК Qrr). В WT максимальное Qrr-опосредованное подавление экспрессии биолюминесценции происходит на ЖК-дисплее (белые квадраты на всех панелях).В штамме qrr 2 + , в котором присутствует только qrr 2, клетки производят от 10 до 100 раз больше света, чем WT на всех стадиях роста (закрашенные ромбики), и мутируют Сайт связывания LuxR ( qrr 2 + luxR-bs ) вызывает дополнительное ~ 10-кратное увеличение биолюминесценции (, незакрашенные ромбики). Та же тенденция сохраняется для qrr 3 (сравните закрытые и открытые треугольники) и qrr 4 (сравните закрытые и открытые кружки). Следовательно, когда в V. функционирует только одна мРНК Qrr.harveyi QS, петля обратной связи LuxR-Qrr играет более важную роль, чем когда присутствуют все Qrr мРНК, предполагая, что наличие нескольких Qrrs-буферов предохраняет схему QS от возмущения, и это предотвращает преждевременное попадание V. harveyi в HCD. , Состояние QS.

Множественные мРНК защищают цепь QS от возмущений. Петля обратной связи LuxR-sRNA была разорвана в штаммах V. harveyi , содержащих только один ген qrr , и была измерена биолюминесценция, зависящая от плотности.WT BB120 (пустые квадраты на всех панелях) и следующие штаммов V. harveyi были протестированы: A. KT280 ( qrr 2 + , закрашенные ромбики), KT381 ( qrr 2 + luxR-bs , открытые ромбы). B. KT300 ( qrr 3 + , закрытые треугольники), KT548 ( qrr 3 + luxR-bs , открытые треугольники). C. KT281 ( qrr 4 + , темные кружки), KT353 ( qrr 4 + luxR-bs , белые кружки). RLU – отсчеты мин. −1 мл −1 / OD 600 .

Обсуждение

Бактерии преодолевают проблему выживания в изменяющейся среде, отслеживая колебания различных параметров в своей среде, и в ответ на изменения этих внешних параметров они вносят соответствующие изменения в экспрессию генов. QS позволяет морской бактерии V. harveyi отслеживать и реагировать на изменения плотности клеточной популяции и видового состава окружающего микробного сообщества. Здесь мы сообщаем о существовании петли отрицательной обратной связи в ядре В.harveyi QS цепь, в которой LuxR, главный регулятор транскрипции QS-контролируемых генов, непосредственно активирует экспрессию мРНК Qrr, что приводит к дестабилизации мРНК luxR . Петля обратной связи LuxR-sRNA влияет на скорость QS-опосредованных изменений во время обоих QS-переходов: от HCD к LCD и от LCD к HCD. Таким образом, петля обратной связи LuxR-sRNA способствует правильному согласованию программ экспрессии генов, которые лежат в основе как индивидуального, так и коллективного поведения.

Ранее мы сообщали о наличии петли обратной связи HapR-sRNA в цепи QS V. cholerae , которая, хотя и является косвенной, тем не менее ускоряет переход бактерий из режима HCD в режим отдельных клеток (Svenningsen et al . , 2008). Поскольку фактор, связывающий HapR с регуляцией генов qrr , остается неизвестным в V. cholerae , мы не смогли разъединить петлю обратной связи и изучить последствия для последующего QS-поведения.К счастью, в случае V. harveyi , поскольку взаимодействие обратной связи LuxR-Qrr является прямым и были идентифицированы сайты связывания ДНК LuxR (Pompeani et al ., 2008), мы могли отключить петлю обратной связи и измерить ее эффекты. .

При переходе от HCD к LCD потеря петли обратной связи LuxR-sRNA не позволяет уровням Qrr увеличиваться до их максимальных уровней. Следовательно, деградация мРНК luxR замедляется, задерживая экспрессию генов, необходимых для индивидуального поведения клеток ().Таким образом, в WT V. harveyi, роль петли обратной связи LuxR-sRNA при переходе от HCD к LCD заключается в ускорении выхода из группового режима и входа в индивидуальный режим клетки. При переходе от LCD к HCD разрыв петли обратной связи LuxR-sRNA делает V. harveyi значительно более чувствительным к AI, чем WT V. harveyi . Таким образом, мутанты, лишенные петли обратной связи, экспрессируют гены, необходимые для группового поведения при более низких концентрациях AI (). Это открытие означает, что в WT при переходе LCD в HCD роль петли обратной связи LuxR-sRNA заключается в активации экспрессии qrr , разрушении мРНК luxR и контроле плотности клеток, при которой популяция покидает особь. режим ячейки и вход в групповой режим.

Отметим, что во время перехода от ЖК-дисплея к HCD контур обратной связи работает в строго ограничивающих условиях LuxR. Это означает, что LuxR должен иметь высокое сродство к промоторам qrr . Соответственно, наши биоинформатические анализы показывают, что сайты связывания LuxR в промоторах qrr более похожи на сайт связывания LuxR-консенсуса, чем сайты связывания LuxR в других известных LuxR-регулируемых генах (Pompeani et al ., 2008). . В совокупности эти исследования предполагают, что, когда он присутствует, LuxR сначала связывается с генами qrr , чтобы инициировать петлю обратной связи и задерживать переход в QS-режим.Только позже, после накопления дополнительного белка LuxR, LuxR связывается с нижележащими генами-мишенями и регулирует их.

Vibrio harveyi и V. cholerae имеют несколько разные петли обратной связи LuxR / HapR-sRNA. LuxR непосредственно активирует экспрессию генов qrr V. harveyi, тогда как HapR не может активировать гены qrr V. cholerae. Кроме того, контур обратной связи в В. harveyi управляет переходом от ЖК-дисплея к HCD, чего нет в В.Холеры . Мы обнаружили, что в штамме V. harveyi Δ luxR задержка экспрессии qrr более значительна, чем задержка в штамме qrr 2,3,4 luxR-bs сразу после Переход от HCD к ЖК-дисплею (). Мы интерпретируем это как означающее, что фактор, отличный от LuxR, действует на гены qrr во время этого перехода. Эти результаты предполагают возможность того, что неизвестный компонент, который связывает HapR с генами V. cholerae qrr , может также функционировать в V.Харвей . Интересно, что ближайшим известным родственником V. harveyi является человеческий патоген Vibrio parahaemolyticus и выравнивание последовательностей промоторов V. harveyi и V. parahaemolyticus qrr 2, qrr 3 и qrr 4. показывает, что все три сайта связывания LuxR по существу законсервированы. Мы предполагаем, что изначально петли обратной связи LuxR / HapR / OpaR [ V. parahaemolyticus (McCarter, 1998)] были косвенными, и это остается так в случае V.Холеры . Прямая регуляция обратной связи LuxR / OpaR генов qrr появилась совсем недавно в V. harveyi и V. parahaemolyticus и, вероятно, обеспечивает некоторое преимущество для ниш, в которых находятся V. harveyi и V. parahaemolyticus , и V. cholerae нет.

LuxR принадлежит к семейству регуляторов транскрипции TetR, большому классу белков, особенно распространенных среди бактерий, подверженных изменениям окружающей среды, таких как почвенные бактерии, патогены растений и животных (Ramos et al ., 2005). Белки TetR-типа играют важную роль в адаптации организмов к колебаниям окружающей среды. Эти белки характеризуются консервативным ДНК-связывающим мотивом спираль-поворот-спираль, но в регуляторных доменах не обнаружена консервация последовательности, что подтверждает их роль в ответе на различные стимулы (Ramos et al ., 2005; Molina-Henares и др. ., 2006; Де Силва и др. ., 2007). Все хорошо охарактеризованные белки типа TetR действуют как репрессоры, где связывание молекулы-индуктора [такой как тетрациклин (Tet) с TetR] вызывает конформационные изменения, а белок типа TetR больше не связывается с ДНК (Hinrichs et al. ., 1994; Орт и др. ., 1999). LuxR / HapR – единственные члены семейства TetR, которые, по-видимому, действуют как активаторы и репрессоры (Showalter et al. ., 1990; Kovacikova and Skorupski, 2002; Pompeani et al. ., 2008). Одна возможность для механизма активации заключается в том, что LuxR / HapR изгибает ДНК в благоприятную конформацию для активации транскрипции. Другая возможность заключается в том, что LuxR / HapR взаимодействует с холоферментом РНК-полимеразы (RNAP) для облегчения активации транскрипции.В соответствии с этими идеями статическое и индуцированное белками изгибание ДНК предоставляет бактериям устройства интеграции сигналов для распознавания внешних воздействий (Perez-Martin and de Lorenzo, 1997).

Хотя механизм, с помощью которого LuxR активирует экспрессию qrr в V. harveyi , еще не определен, мы знаем, что экспрессия генов qrr требует, чтобы LuxO˜P работал в сочетании с альтернативным сигма-фактором 54 (Лилли и Басслер, 2000; Ленц и др. ., 2004). σ 54 -промоторы обладают уникальной особенностью, заключающейся в том, что их связанные активаторы (например, LuxO˜P) могут действовать на расстоянии, обычно 100–200 п.н., через петли ДНК, чтобы вступить в контакт с холоферментом RNAP (Wigneshweraraj et al ., 2008. ). Архитектура σ 54 -зависимых промоторов делает их идеальными для того, чтобы позволить дополнительным факторам (например, LuxR) связываться и способствовать оптимальной геометрии промотора для активации транскрипции. Действительно, Fis, небольшой гомодимер белка, который обычно изгибает ДНК на 90 ° при связывании с родственными сайтами-мишенями (Perez-Martin et al ., 1994) связывается с промежуточной последовательностью ДНК между сайтами связывания LuxO˜P и σ 54 –RNAP и требуется для активации qrr в V. cholerae (и предположительно в V. harveyi ) (Lenz and Басслер, 2007). В случае LuxR сайты связывания в промоторах V. harveyi qrr 2, qrr 3 и qrr 4 расположены относительно далеко, примерно на 30-40 п.н. выше сайта связывания LuxO˜P, чем типичен для сайтов связывания вспомогательных факторов транскрипции, предполагая, что LuxR не функционирует с помощью обычного механизма активации.Например, связывание LuxR с промоторами qrr 2, qrr 3 и qrr 4 может блокировать связывание негативного регулятора, который консервативен в E. coli , что приводит к активации экспрессии (см.). В настоящее время мы изучаем механизм, с помощью которого LuxR действует как активатор.

Малые регуляторные РНК, функционирующие в петлях обратной связи, недавно стали важными регуляторными модулями как у бактерий, так и у высших организмов (Gottesman et al ., 2006; Цанг и др. ., 2007). МикроРНК (миРНК) аналогичны бактериальным малым РНК и обеспечивают посттранскрипционную регуляцию генов в эукариотических организмах путем связывания с комплементарными последовательностями в 3′-НТО мРНК. Крупномасштабный вычислительный анализ данных экспрессии генов в клетках млекопитающих показывает, что miRNA-обеспечиваемая регуляция обратной связи, как положительная, так и отрицательная, является повторяющейся темой, которая, вероятно, увеличивает надежность регуляции генов (Tsang et al ., 2007). Двойная отрицательная петля обратной связи с участием множественных miRNAs, как недавно было показано, контролирует решение судьбы нейрональных клеток у нематоды Caenorhabditis elegans (Johnston et al ., 2005). В Pseudomonas fluorescens CHAO три избыточных мРНК – RsmXYZ, секвестрируют белки RsmA и RsmE, которые также могут по обратной связи активировать транскрипцию rsmXYZ (Kay et al ., 2005; 2006; Reimmann et al ., 2005), аналогичное регулированию обратной связи LuxR-Qrr, представленное в этом исследовании. Важность sRNA-опосредованных петель обратной связи в быстрых стрессовых ответах у E. coli и Salmonella typhimurium подчеркивается RybB, мРНК, которая активируется альтернативным сигма-фактором E .RybB осуществляет обратную связь для подавления экспрессии σ E , что имеет решающее значение для гомеостаза клеточной оболочки. В условиях мембранного стресса RybB также необходим для быстрой элиминации мРНК, кодирующих определенные белки внешней мембраны (Papenfort et al ., 2006; Thompson et al ., 2007). Учитывая, что петли положительной обратной связи обычно управляют переключаемыми необратимыми процессами, специфическая роль регуляторных РНК в регуляции отрицательной обратной связи может заключаться в тонкой настройке, т.е.е. для установки и поддержания устойчивого состояния целевого белка (Tsang et al ., 2007). По сравнению с репрессорами транскрипции, регуляторные РНК могут быть особенно эффективными, потому что они контролируют свои целевые белки на посттранскрипционном уровне и, таким образом, ускоряют ответ от вышестоящих входов. Эта способность, вероятно, приводит к эффективной буферизации шума и обеспечивает равномерную экспрессию целевого белка в популяции (Leung and Sharp, 2007).

Анализ топологий сети в E.coli предсказывают, что половина его факторов транскрипции негативно саморегулируется (Rosenfeld et al ., 2002). Сходным образом LuxR репрессирует собственную транскрипцию (Chatterjee et al ., 1996). Отрицательная ауторегуляция ускоряет время реакции на изменения экспрессии генов, а также ограничивает транскрипционные выходы в узких пределах, несмотря на широко колеблющиеся входные данные (Rosenfeld et al ., 2002; Seshasayee et al ., 2006). Поскольку LuxR является главным регулятором транскрипции большого набора генов-мишеней QS в V.harveyi , важно, чтобы уровни LuxR строго контролировались, чтобы гарантировать, что популяция выявляет точно синхронизированный паттерн экспрессии генов в ответ на изменение концентрации AI. Описанная здесь петля обратной связи LuxR-sRNA может быть особенно эффективной в модулировании изменений экспрессии генов, поскольку уровни белка LuxR отрицательно контролируются как на посттранскрипционном, так и на транскрипционном уровнях. Предположительно, двойные петли отрицательной обратной связи, которые контролируют уровни LuxR, обеспечивают равномерную экспрессию LuxR в популяции клеток, что является критическим для обеспечения синхронности в групповом поведении.

Экспериментальные процедуры

Бактериальные штаммы и условия роста

Все штаммы V. harveyi произошли от BB120 (Bassler et al ., 1997) и были выращены в аэробных условиях при 30 ° C в Luria-marine (LM) или Бульон Autoinducer Bioassay (AB). E. coli S17–1λ pir использовали для размножения плазмид при 37 ° C в среде LB. Использовали следующие антибиотики: ампициллин, 100 мкг мл -1 ; Tet, 10 мкг мл -1 ; канамицин (Кан), 100 мкг мл -1 ; хлорамфеникол (Cm), 10 мкг мл -1 ; гентамицин, 100 мкг / мл -1 и полимиксцин B, 50 ед. мл -1 .Рост бактерий контролировали путем измерения оптической плотности при 600 нм.

Манипуляции с ДНК

Все манипуляции с ДНК выполняли с использованием стандартных процедур (Sambrook et al ., 1989). ДНК-полимеразу, усиленную Herculase (Stratagene), использовали для реакций клонирования ПЦР, а полимеразу Taq (Roche) использовали для всех других реакций ПЦР. dNTP, эндонуклеазы рестрикции и ДНК-лигаза Т4 были получены от New England BioLabs. Наборы для очистки ДНК были предоставлены QIAGEN.Последовательности праймеров доступны по запросу. делеции V. harveyi были сконструированы с использованием ранее описанных методов (Даценко и Ваннер, 2000), и конструкции были введены в хромосому V. harveyi путем аллельной замены (Bassler et al ., 1993). Для конструирования мутантов LuxR-bs предсказанные сайты связывания LuxR в промоторах qrr 2 и qrr 4 были мутированы в последовательность TTAGTTTGATCTGCTTAATAAA, которая не связывается с LuxR, как было показано с помощью анализа сдвига геля ( А.Помпеани, неопубликован. данные). Для сайта связывания qrr 3 LuxR две базы были изменены на TAGTGAATTAATTCAGCATTA вместо рандомизации всего сайта, поскольку рандомизация всего сайта серьезно повлияла на экспрессию qrr 3. Мутации LuxR-bs для qrr 2,3,4 были сконструированы в праймеры, используемые в методе замены гена, как описано ранее (Datsenko and Wanner, 2000). слитых промоторов qrr-gfp клонировали в pSLS3, производное pCMW1 (Waters and Bassler, 2006), с использованием сайтов рестрикции BclI и SalI.Плазмиды трансформировали в E.coli в кюветах для электропорации 0,2 см (USA Scientific) с использованием Bio-Rad Micro Pulser TM .

Анализ сдвига подвижности геля

LuxR и HapR очищали с помощью системы очистки белков IMPACT (NEB) с использованием экспрессионной плазмиды pTYB11 и протокола, описанного в инструкциях производителя. Очищенный LuxR хранили в 20 трис (pH 7,5), 1 EDTA, 10 NaCL и 0,1 DTT с 20% глицерином, как описано ранее (Waters and Bassler, 2006).ДНК-зонды для анализа сдвига подвижности геля были получены с использованием 5′-меченных флуоресцентных праймеров в стандартной реакции ПЦР, которая амплифицировала 275 пар оснований перед каждым промотором qrr . Зонды очищали после электрофореза в агарозном геле с использованием набора для восстановления ДНК Zymoclean Gel (Zymo Research). Каждый зонд (10 нМ) инкубировали с указанным количеством LuxR (6,25-500 нМ) и 1 мкл 1 мг / мл -1 poly dIdC в конечном объеме 20 мкл при 30 ° C в течение 15 мин. Сдвиги подвижности геля выполняли на 5% TAE-полиакрилимидном геле и визуализировали с помощью системы визуализации Storm 860 (Molecular Dynamics).

Анализ экспрессии gfp

Все анализы экспрессии gfp были выполнены на сортировщике клеток Becton Dickinson FACSAria, и данные были проанализированы с использованием программного обеспечения FACS Diva. Для мониторинга экспрессии qrr-gfp в E. coli культуры выращивали в 2 мл LB + Tet, Cm в течение 12 ч в трех повторностях при 30 ° C с аэрацией. Штамм E. coli , использованный в исследованиях экспрессии gfp , – это MC4100. Аллель luxO D47E был клонирован в pBBR322 в сайтах EcoRI и BamHI и интегрирован в сайт λ att с помощью метода λInCh2, как описано ранее (Boyd et al ., 2000) для создания штамма КТ1190. Либо luxR на pLAFR2 (pKM699), либо пустой вектор pLAFR2 трансформировали в штамм KT1190 вместе с репортерной конструкцией qrr-gfp для проведения анализа.

Анализы биолюминесценции

Vibrio harveyi Экспрессию биолюминесценции измеряли с помощью анализа, который был описан ранее (Bassler et al ., 1993). Вкратце, культур V. harveyi выращивали в течение 14 ч в среде LM при 30 ° C с аэрацией.Культуры разводили 1: 5000, и после этого светопродукцию и OD 600 измеряли каждые 45 минут. Относительные световые единицы (RLU) определяются как минимум -1 мл -1 / OD 600 . Для экспериментов с кривой доза-ответ культуры выращивали в течение 14 часов в среде AB, а затем разбавляли 1: 1000 в свежей среде AB. В 96-луночном микротитрационном планшете 90 мкл культуры добавляли к 5 мкл 100 мкМ HAI-1 и 5 мкл 100 мкМ AI-2, и проводили серийные разведения до конечных концентраций 10 пМ в целом обоих HAI-1. и АИ-2.Культуры выращивали в течение 6 ч в четырех повторностях, и биолюминесценцию и OD 600 измеряли с использованием планшет-ридера Perkin Elmer EnVision.

Количественный анализ ПЦР в реальном времени

Штаммы Vibrio harveyi выращивали в течение 14 часов и затем разводили 1: 500. Клетки осаждали на LCD (OD 600 ~ 0,025) и при HCD (OD 600 -1,5) и замораживали при -80 ° C. РНК выделяли с использованием набора Ribo-Pure TM -Bacteria (Ambion / ABI). Образцы обрабатывали ДНКазой I (Ambion / ABI).РНК количественно определяли на спектрофотометре NanoDrop® ND-1000 (NanoDrop Technologies). ПЦР-анализ в реальном времени проводили, как описано ранее (Tu and Bassler, 2007). hfq использовали в качестве эндогенного контроля, праймеры доступны по запросу.

Нозерн-блот-анализ

Культуры Vibrio harveyi выращивали до OD 600 -1,5 в среде LM с 5 мкМ каждого HAI-1 и AI-2. Культуры дважды промывали и ресуспендировали в LM без AI.Аликвоты для препарата РНК собирали в указанные моменты времени после добавления свежей среды, смешивали с 0,2 объема стоп-раствора и мгновенно замораживали в жидком азоте (Papenfort et al ., 2008). После оттаивания на льду общая РНК была выделена, как описано (Svenningsen et al ., 2008). Нозерн-блоттинг выполняли, как описано (Martin et al , 1989), за исключением того, что одноцепочечные ДНК-зонды получали с помощью асимметричной ПЦР. Последовательности праймеров доступны по запросу.Мембраны первоначально зондировали на Qrr4, затем удаляли промывкой 0,5% SDS в течение 30 минут при 95 ° C и перепробировали на мРНК LuxR, и, наконец, снимали и перепробовали на 5S РНК. Интенсивность сигналов определяли количественно с использованием системы анализа изображений Alpha Innotech FluorChem.

Цитирование

Введение

Пресноводные грибы – это грибы, которые на протяжении всего или части своего жизненного цикла встречаются в пресноводной среде обитания (Thomas 1996, Wong et al. 1998), и они являются эволюционно важной группой (Vijaykrishna et al.2006 г.). Членами пресноводных грибов могут быть сапробионты, паразиты, эндофиты и мутуалистические таксоны (Виджайкришна и др., 2005 г., Чжан и др., 2008 г., Све и др., 2009 г., Джонс и др., 2014 г., Хуанг и др., 2018). Пресноводными грибами-хозяевами могут быть самые разные организмы, такие как древесина, растения, водоросли, пена, рыба и т. Д. (Sparrow 1960, Ellis and Ellis 1985, Jones et al. 2014). Однако многие исследования пресноводных грибов были сосредоточены на одревесневших пресноводных грибах (Tsui et al.2000, Cai et al.2002, Luo et al.2004, 2018, Джонс и др. 2014, Hyde et al. 2016, Ян и др. 2017), которые были определены как те грибы, которые растут на затопленных древесных остатках в пресноводных ручьях, прудах, озерах и дуплах деревьев (Hyde et al., 2016). Они также растут на затопленной древесине в торфяных болотах и ​​плотинах (Pinnoi et al. 2006, Pinruan et al. 2007, 2014, Hu et al. 2010). Лигниколистые пресноводные грибы представляют собой разнообразную группу, включающую виды из разных типов (Aphelidiomycota, Ascomycota, Basidiomycota, Blastocladiomycota, Chytridiomycota, Monoblepharomycota, Mortierellomycota и Rozellomycota) (Shearer et al.2007, Кагами и др. 2012 г., Чжан и др. 2012 г., Джонс и др. 2014 г., Wijayawardene et al. 2018). Доминирующими группами одревесневших пресноводных грибов являются Dothideomycetes и Sordarialmycets (Jones et al., 2014, Hyde et al., 2016, Wijayawardene et al., 2017, 2018).

Мы изучаем разнообразие лигниколистых пресноводных грибов в Таиланде, чтобы установить филогенетические взаимоотношения лигниколистных пресноводных грибов, понять естественную классификацию этой группы и внести свой вклад в биогеографическое разнообразие грибов (Hyde et al.2016). Исследование пресноводных грибов в Таиланде было впервые проведено Tubaki et al. (1983), и они сообщили о 40 видах пресноводных грибов из пены. Впоследствии микологи начали изучать одревесневшие пресноводные грибы в Таиланде, и было зарегистрировано несколько таксонов (Sivichai et al. 1998, 1999, 2000, 2002, 2010, Jones et al. 1999, Marvanová et al. 2000, Hu et al. 2010, Zhang et al.2013, Luo et al.2015, 2016, Bao et al.2018).

Lentitheciaceae был введен Zhang et al.(2012) для включения Massarina-подобных видов в отряд Pleosporales. В настоящее время в этом семействе принято 13 родов (Dayarathne et al. 2018, Hyde et al. 2018). Виды этого семейства широко распространены в мире (Китай, Египет, Венгрия, Италия, Япония, Россия, Саудовская Аравия, Таиланд, Великобритания, Узбекистан) и обычно сапробируют стебли и ветки травянистых и древесных растений в наземных или водных средах обитания ( Wanasinghe et al.2014, 2018, Knapp et al.2015, Wijayawardene et al.2015, Luo et al.2016, Тибпромма и др. 2017, Hyde et al. 2018). Род Tingoldiago был установлен Hirayama et al. (2010) с единственным видом Tingoldiagograminicola K. Hiray. & Каз. Tanak, этот вид первоначально считался Massarinaingoldiana. Позже Хираяма и др. (2010) провели повторную оценку филогении Massarinaingoldiana и представили два новых рода Tingoldiago и Lindgomyces для размещения Massarinaingoldianasensu lato на основе филогенетического анализа. В настоящее время в этот род принят только один вид.

В этой статье мы представляем два новых пресноводных вида Tingoldiago (Lentitheciaceae) на основе морфомолекулярных исследований. Предоставляются подробные описания и иллюстрации этих двух новых видов.

Материалы и методы Сбор, изоляция и морфологические исследования

Образцы гниющей древесины были собраны в Тат Фаном, Накхон Фаном, Таиланд, и доставлены в лабораторию в пластиковых пакетах. Образцы инкубировали в пластиковых ящиках, выстланных влажной папиросной бумагой, при комнатной температуре в течение одной недели.Наблюдения за образцами и морфологические исследования проводились в соответствии с протоколами, предоставленными Luo et al. (2018).

Чистые культуры получали путем выделения отдельных спор с последующим Chomnunti et al. (2014). Прорастающие аскоспоры в асептических условиях переносили на чашки с картофельным агаром с декстрозой (PDA) и выращивали при 16-25 ° C при дневном свете. Цвет колонии и другие признаки наблюдали и измеряли через три недели. Образцы были депонированы в гербарии Университета Маэ Фах Луанг (MFLU), Чианграй, Таиланд.Живые культуры хранятся в Коллекции культур Университета Маэ Фах Луанг (MFLUCC). Числа Facesoffungi и Index Fungorum были получены после Jayasiri et al. (2015) и Index Fungorum (2019). Новые виды были установлены в соответствии с рекомендациями Jeewon and Hyde (2016).

Экстракция ДНК, ПЦР-амплификация и секвенирование.

Мицелий грибов соскабливали с поверхности колоний, выращенных на планшете PDA или MEA при 25 ° C в течение 4 недель, переносили в центрифужную пробирку на 1,5 мл и измельчали ​​с использованием жидкого азота.Набор гДНК грибов EZ geneTM (GD2416) использовали для экстракции ДНК из измельченного мицелия в соответствии с инструкциями производителя. Области генов большой субъединицы ядерной рибосомальной ДНК (LSU), внутренних транскрибируемых спейсеров (ITS), малой субъединицы ядерной рибосомной ДНК (SSU) и РНК фактора элонгации трансляции (TEF1-α) были амплифицированы с использованием пары праймеров LR0R / LR7 (Vilgalys и Hester 1990), ITS5 / ITS4, NS1 / NS4 (White et al. 1990) и 983F / 2218R (Liu et al. 1999) соответственно.Реакции амплификации проводили в 25 мкл смесей для ПЦР, содержащих 9,5 мкл ddH 2 O, 12,5 мкл 2 × PCR MasterMix (Tsingke Co., Китай), 1 мкл образца ДНК и 1 мкл каждого праймера. Программа теплового цикла ПЦР для амплификации LSU, ITS, SSU и TEF1-α была следующей: 94 ° C в течение 3 минут, затем 35 циклов денатурации при 94 ° C в течение 30 секунд, отжиг при 56 ° C в течение 50 секунд, удлинение при 72 ° C в течение 1 минуты и окончательное удлинение при 72 ° C в течение 10 минут и, наконец, выдержка при 4 ° C.ПЦР-амплификацию подтверждали на 1% гелях для электрофореза в агарозе, окрашенных бромидом этидия. Продукты ПЦР секвенировали с использованием того же набора праймеров, который использовался в ПЦР в Beijing Tsingke Biological Engineering Technology and Services Co. Ltd. (Пекин, Китай).

Секвенирование и выравнивание последовательностей

Последовательность была собрана с помощью BioEdit, и последовательности с высокими индексами сходства были определены с помощью поиска BLAST для поиска наиболее близких совпадений с таксонами у Lentitheciaceae и из недавно опубликованных данных (Dayarathne et al.2018). Все согласованные последовательности и эталонные последовательности были выровнены с использованием MAFFT v.7 (http://mafft.cbrc.jp/alignment/server/index.html) (Katoh and Standley 2013), затем проверены визуально и оптимизированы вручную с помощью BioEdit v. 7.0.9 (зал 1999). Неоднозначные области были исключены из анализа, а пробелы рассматривались как отсутствующие данные. Инструмент веб-сайта филогении «ALTER» (Glez-Peña et al. 2010) использовался для преобразования файла выравнивания fasta в формат Phylip для анализа RAxML и Clustalx BETA и PAUP 4.0 использовались для преобразования файла fasta выравнивания в файл Nexus для байесовского анализа. Филогенетические анализы были получены с помощью анализа максимального правдоподобия (ML), максимальной экономии (MP) и байесовского анализа.

Филогенетический анализ

Деревья максимального правдоподобия были созданы с использованием RAxML-HPC2 на XSEDE (8.2.8) (Stamatakis 2006, Stamatakis et al. 2008) на платформе CIPRES Science Gateway (Miller et al. 2010) с использованием модели GTR + I + G эволюция, которая была оценена с помощью MrModeltest 2.2 (Nylander et al.2008 г.). Значения максимального правдоподобия (ML), равные или превышающие 75%, указаны над каждым узлом (рисунок 1).

10.3897 / mycokeys.65.49769.figure1C12B9438-22A8-57BE-BCE2-1F70C432752F Рисунок 1.

Филогенетическое дерево на основе RAxML-анализа объединенных данных последовательностей LSU, SSU, ITS и TEF1-α. Значения поддержки бутстрапа для максимальной вероятности (ML, черный) и максимальной экономии (MP, красный) выше 75% и байесовской апостериорной вероятности (PP, черный) больше 0.95 обозначены над узлами как MP / ML / PP. Штаммы ex-типа выделены жирным шрифтом, а вновь полученные изоляты – красным. У корней дерева Corynesporasmithii (CABI5649b) и Corynesporacassiicola (CBS100822).

https://binary.pensoft.net/fig/394429 Анализ

MP был выполнен с использованием опции эвристического поиска с добавлением 1000 случайных таксонов и делением пополам и повторным соединением дерева (TBR) в качестве алгоритма обмена ветвями. Все символы были неупорядоченными и одинакового веса, а пробелы считались недостающими данными.Максимальные деревья были неограниченными, ветви нулевой длины были разрушены, и все многочисленные, одинаково экономные деревья были сохранены. Стабильность клады оценивали с помощью бутстрап-анализа (BS) с 1000 повторами, каждая с десятью повторами случайного пошагового добавления таксонов (Hillis and Bull 1993).

Байесовский анализ был выполнен с помощью MrBayes v3.2 (Ronquist et al., 2012), с использованием наиболее подходящей модели эволюции последовательности, оцененной с помощью MrModeltest 2.2 (Nylander et al., 2008) для оценки апостериорных вероятностей (PP) (Rannala and Yang 1996, Жакыбаева и Гогартен 2002) методом Монте-Карло цепи Маркова (MCMC).Шесть одновременных цепей Маркова были запущены для 10 000 000 поколений, деревья отбирались каждые 1000 -го поколения , и было получено 1 0000 деревьев. На основе трассерного анализа первые 1000 деревьев, составляющих 10%, были отброшены в качестве фазы приработки в анализе. Остальные деревья использовались для вычисления апостериорных вероятностей в дереве консенсуса правила большинства (критическое значение для диагностики топологической сходимости установлено на 0,01).

Филограммы визуализированы на Рис.4.2 (Rambaut 2014) и выполнен в Adobe Illustrator CS5 (Adobe Systems Inc., США). Все вновь созданные последовательности этого исследования были отправлены в GenBank.

Таблица 1.

Таксонов, используемых в этом исследовании, и их регистрационные номера в GenBank, вновь созданные последовательности обозначены *, а типовые штаммы выделены жирным шрифтом.

Таксоны штамм Регистрационный номер GenBank
LSU СБУ ЕГО ТЭФ1
Bambusicolabambusae MFLUCC 11–0614 JX442035 JX442039 NR121546 KP761722
Б.irregulispora MFLUCC 11–0437 JX442036 JX442040 NR121547 KP761723
B.massarinia MFLUCC 11–0389 JX442037 JX442041 NR121548
Bimurianovaezelandiae AFTOL ID931 DQ471087
Byssotheciumcircinans CBS67592 GU205217 GU205235 GU349061
Коринеспоракассиикола CBS100822 GU301808 GU296144 GU349052
С.smithii CABI5649b GU323201 GU349018
Dacampiaengeliana 72868 КТ383791
Д.проститутка 74269 КТ383793
D.hookeri 81840 КТ383795
Darksideaalpha CBS 135650 KP184019 KP184049 NR137619 KP184166
Д.бета CBS 135637 KP184023 KP184049 NR137957 KP184189
D.delta CBS 135638 NR137075
Д.эпсилон CBS 135658 KP184029 KP184070 NR137959 KP184186
D.gamma CBS 135634 KP184031 KP184073 NR137587 KP184188
Д.zeta CBS 135640 KP184013 KP184071 NR137958 KP184191
Falciformisporalignatilis BCC 21117 GU371826 GU371834 KF432942 GU371819
Ф.лигнатилис BCC 21118 GU371827 GU371835 KF432943 GU371820
Halobyssotheciumobiones 27AV2385 KX263864
ЧАС.обионы MFLUCC 15–0381 Mh476744 Mh476745 Mh477060 Mh476746
Helicascusnypae BCC36752 GU479789 GU479755 GU479855
Kalmusiascabrispora КТ2202 AB524594 AB524453 AB539107
Карстенулярходостома CBS69094 GU301821 GU296154 GU349067
Katumotoabambusicola КТ1517а AB524595 AB524454 LC014560 AB539108
Keissleriellabreviasca КТ649 AB807588 AB797298 AB808567
К.culmifida КТ2642 AB807592 AB797302 LC014562
K.gloeospora КТ829 AB807589 AB797299 LC014563
К.poagena CBS136767 KJ869170 KJ869112
K.quadriseptata КТ2292 AB807593 AB797303 AB811456 AB808572
К.taminensis КТ571 AB807595 AB797305 LC014564 AB808574
K.trichophoricola КОС 136770 KJ869171 KJ869113
Lentitheciumclionina КТ1149А AB807540 AB797250 LC014566 AB808515
Л.флювиатил CBS 123090 FJ795450 FJ795492
L.pseudoclioninum КТ1111 AB807544 AB797254 AB809632 AB808520
Massarinacisti CBS 266 62 FJ795447 FJ795490 LC014568 AB808514
М.эбурнеа КОС 473 64 GU301840 GU296170 GU349040
Montagnulaopulenta АФТОЛИД 1734 DQ678086 AF164370
Morosphaeriaramunculicola JK5304B GU479794 GU479760
Murilentitheciumclematidis IT1078 КМ408758 КМ408760 KM408756
М.клематидис MFLUCC 14–0562 КМ408759 KM408761 КМ408757 КМ454445
Neoophiosphaerellasasicola КТ1706 AB524599 AB524458 LC014577 AB539111
Palmiascomagregariascomum MFLUCC 11–0175 KP744495 KP753958 KP744452
Paraconiothyriumbrasiliense CBS100299 JX496124 AY642523 JX496011
Paraphaeosphaeriamichotii MFLUCC 13–0349 KJ939282 KJ939285 KJ939279
П.минитаны CBS122788 EU754173 EU754074 GU349083
Phaeodothiswinteri CBS18258 GU296183
Phragmocamarosporiumplatani MFLUCC 14–1191 KP842915 KP842918
Pleurophomaossicola CBS139905 KR476769 KR476736
П.оссикола CPC24985 KR476770 NR137992
Pleurophomapleurospora CBS130329 JF740327
Poaceascomaaquaticum MFLUCC 14–0048 КТ324690 КТ324691
П.галофила MFLUCC 15–0949 MF615399 MF615400
P.helicoides MFLUCC 11–0136 KP998462 KP998463 KP998459 KP998461
Pseudomurilentitheciumcamporesii MDLUCC 14-1118 MN638846 MN638850 MN638861
Setoseptoriaarundinacea кт600 AB807575 AB797285 LC014595 AB808551
С.Magniarundinacea КТ1174 AB807576 AB797286 LC014596 AB808552
S.phragmitis CBS 114802 KF251752 KF251249
С.scirpi MFUCC 14–0811 KY770982 KY770980 MF939637 KY770981
Стагоноспорамакропикниды КОС 114202 GU301873 GU296198 GU349026
Tingoldiagograminicola Х255 AB521745 AB521728 LC014599 AB808562
Т.graminicola KH68 AB521743 AB521726 LC014598 AB808561
T.graminicola КТ891 AB521744 AB521727 AB808563
* Т.hydei MFLUCC 19-0499 MN857177 MN857181
* T.clavata MFLUCC 19-0496 MN857178 MN857186 MN857182
* Т.ключица MFLUCC 19-0498 MN857179 MN857187 MN857183
* T.clavata MFLUCC 19-0495 MN857180 MN857188 ​​ MN857184
Towysporaaestuari MFLUCC 15–1274 KU248852 KU248853 NR148095
Trematosphaeriapertusa CBS 122368 FJ201990 FJ201991 NR132040 KF015701
Trematosphaeriapertusa КОС 122371 GU301876 GU348999 KF015669 KF015702
Обсуждение

В течение последнего десятилетия пресноводные грибы в Таиланде были зарегистрированы в основном с севера, юга и северо-востока Таиланда (Jones et al.1999, Marvanová и Hywel-Jones 2000, Sivichai and Boonyuen 2010, Sivichai and Hywel-Jones 1999, Sivichai et al. 1998, 2000, Шри-индрасутдхи и др. 2010). О пресноводных грибах из Восточного Таиланда пока не сообщалось. В этом исследовании два новых пресноводных вида, а именно. Tingoldiagohydei и T.clavata из Восточного Таиланда были интродуцированы на основании морфологии и филогении. Tingoldiagohydei и T.clavata удовлетворяют общей концепции рода Tingoldiago (Hirayama et al. 2010). Они включают от шаровидных до конических, погруженных в выпирающие аскоматы, клеточные псевдопарафизы, битуминозные, расщепляющиеся аски и булавовидные аскоспоры со средней первичной перегородкой и большой веретенообразной студенистой оболочкой вокруг аскоспоры (Hirayama et al.2010). Морфологически T.hydei и T.clavata очень похожи, так как имеют схожую форму асков и аскоспор; однако мы можем различить их по размеру аскомат, асков и аскоспор (таблица 2). Кроме того, мы также сравнили морфологические различия этих двух видов с типовым видом T.graminicola. Аскопоры T.hydei и T.clavata являются гиалиновыми, односептными, с придатками на перегородке, а верхние клетки шире и короче, чем нижние клетки, в то время как аскопоры T.graminicola – бесцветные, односептные, но с возрастом становятся коричневыми и трехсептическими, без придатков на перегородке, верхние и нижние клетки имеют одинаковую длину. Филогенетический анализ показал, что два наших новых изолята сгруппированы вместе и являются сестрой типового вида Tingoldiagograminicola с сильной поддержкой бутстрапа (100 ML / 92 MP / 1.00 PP). Эти данные убедительно подтверждают, что наши два изолята являются новым видом.

Таблица 2.

Морфологические сравнения видов Tingoldiago, обсуждаемые в данном исследовании.

Таксоны Распределение Ascomata (мкм) Псевдопарафизы (мкм) Asci (мкм) Аскоспоры (мкм) Список литературы
Tingoldiagograminicola Япония, Великобритания 150–250 × 250–450 1.5–4 87,5–122 × 18,25–25 43,5–53 × 7,5–11 Hirayama et al. 2010
T.hydei Таиланд 180–280 × 330–470 1,8–2,5 95–164 × 18–22 37,5–42 × 7,5–9 Это исследование
Т.ключица Таиланд 145–210 × 145–195 1,4–2,0 110–148 × 20–27 48–51 × 7,5–8,5 Это исследование

Hyde et al. (2020) представили новый род Pseudomurilentithecium у Lentitheciaceae. В их филогенетическом анализе Pseudomurilentithecium сгруппировался с Poaceascoma и был базальным по отношению к Lentitheciaceae.Однако в нашем филогенетическом анализе Pseudomurilentithecium сгруппирован с представителями Massarinaceae, а не Lentitheciaceae. Следовательно, необходимы дальнейшие исследования, чтобы подтвердить размещение рода.

Tingoldiago – хорошо разрешенный род в этом семействе со стабильной кладой в пределах Lentitheciaceae. Род можно отличить от других родов этого семейства по наличию гиалиновых односептных клеток, верхние клетки широкие, а базальные клетки – узкие аскоспоры с большой веретенообразной студенистой оболочкой.Оболочка считается адаптацией рода, которая позволяет аскоспорам прикрепляться к субстратам в движущейся воде (Shearer 1993, Hyde and Goh 2003, Jones 2006, Devadatha et al.2019). Сообщается, что род Tingoldiago встречается исключительно в пресноводных местообитаниях (Hirayama et al. 2010), а два наших новых вида были собраны в лотковых местообитаниях реки Меконг.

Как сделать из динамика душевное. Звук Punitioner своими руками. Схема и принцип работы

Watchdog на одном транзисторе – самая простая схема, которую сможет собрать даже дошкольник.

В твои владения часто вторгаются без спроса, и при этом ты работаешь важная?)


Пора эти проблемы забыть! Представляю вашему вниманию схему сторожевого пса всего в одном! Благодаря такой схеме вы сможете обезопасить свой дом и принять все необходимые меры для устранения возникших проблем!

Схема и принцип работы

А вот схема

Коболевка (расположение выводов) транзистора CT815B выглядит так:


Принцип действия очень простой.При обрыве провода безопасности начинает пищать зуммер. Тонкую охлаждающую проволоку можно протянуть через дверной проем.

Точнее опишите работу схемы, она будет выглядеть так:

Нарисуйте схему по ГОСТу для удобства восприятия

Пока что у нас есть предохранительный провод, который в цепи плюс аккумуляторы – резистор 100 К – по охранному проводу будет протекать ток. Весь ток будет проходить через защитный трос, так как его сопротивление очень мало.Поскольку весь ток будет протекать по проводу, открытия транзистора недостаточно. Транзистор открывается только тогда, когда его напряжение между базой и эмиттером будет 0,5-0,7 вольт.

Но … как только предохранительный провод обрывается, сразу резко возрастает напряжение, то есть становится больше 0,5-0,7 вольт и начинает течь через базу-эмиттер. Поскольку ток течет через основной эмиттер, значит, транзистор открывается. А раз он открывается, значит через цепочку плюс аккумуляторы – зуммер-коллектор – на эмиттер начинает течь ток.Пока через зуммер течет ток, он орет, как крашеный.

Сборка и работа на практике

Схема состоит из транзистора CT815 с любой буквой. Взял вот это:

Какая странная маркировка на транзисторе? Раньше так обозначали советские транзисторы. Опытные радиолюбители сразу определят, что это транзистор CT815B. Новичкам советую скачать программу транзисторов V1.0, которая позволит легко определять советские транзисторы даже по цветовой маркировке.

Вот пример транзистора, который я использую в схеме:


На схеме тоже есть зуммер:


Зуммер пустой звук. При подаче на него постоянного напряжения , он начинает пищать высокочастотным неприятным монотонным звуком. Брал на Алиэкспресс за 0,7 бакса по этой ссылке .

Часто путаемые зуммеры с пьезоизлучателями (внизу на фото):

Если разобрать зуммер, то мы увидим схему генератора частоты, выполненного в SMD исполнении, а также сам пьезоэмиттер, покрытый пленкой. медные провода к этой косынке.


Так что, если вы возьмете зуммер на радиорынке, обратитесь к продавцу, вы не подсунете обычный пьезоэмиттер.

Вместо зуммера можно взять лампочку малой мощности или любой актуатор, который будет включаться через реле. В этом случае не забудьте защитить транзистор, включив катушку параллельно. Защитный диод:

Ну вот собственно видео работы всей схемы. Оранжевый провод – это тип проводки ограждения.

Схема, представленная в этой статье, очень проста в повторении и не должна вызывать затруднений при сборке.
Может использоваться в различных устройствах для звукового оповещения. Например, сигнализация, звуковое дублирование сигнала поворота в автомобиле или байке, сигнал о разряде аккумуляторов и так далее. Конечно, можно взять готовый биппер, например, из старого китайского будильника, музыкальной открытки или других устройств, но я решил сделать его своими руками. Так что это интересно.
Еще одна цель собрания – популяризация энтузиазма молодежной радиоэлектроники. Если этот сайт способен увлечь такими интересными и хорошими вещами хотя бы нескольких человек, то задание можно считать выполненным.
Схема взяла простая, но проверенная. Уже не помню откуда у меня.

Схема звуковой панели

Детали для сборки звукового сигнала

Детали для схемы можно использовать в очень широком диапазоне.
Например, микросхемы Ла7 серии К176, К164, К564, К561 или К561Л5 или импортные аналоги.Чтобы микросхема не растекалась и не вытягивалась, лучше всего взять специальную контактную площадку и превратить ее в схему (копейки), а замена микросхемы займет секунды, к тому же при пайке есть нет риска, что микросхема будет перегружена или повредит статическое электричество. Кроме того, вы можете легко испытать различные марки микросхем по производительности.
Конденсатор С1Полярный на напряжение не менее 15 вольт, но емкостью от 47 до 500 мкФ. Если вы хотите, чтобы зуммер после выключения питания отключился, то этот конденсатор нужно исключить, иначе после выключения питания звук продолжается до тех пор, пока конденсатор не разрядится.
КОНДЕНСАТОР C2 керамический от 0,1 до 0,47 мкФ. Они обозначены цифрами на крышке – 104, 154, 224, 474.
Резистор R1 от 5 до 50 кОм. Мощность любая, но лучше поменьше. Чтоб габариты были не большими.
Потенциометр R2 от 68 до 500 кОм. По мощности меньше.
Диод можно использовать вообще как угодно. Используется для защиты микросхемы от неправильного подключения питания. Без него можно обойтись.


Излучатель звуковой ЗП-3 или аналогичный.


Как подключить зп-3? Если радиаторы звука СП-3 новые, то необходимо припаять провода, как на фото. Использовать флюс несложно. Один провод припаиваем к мембране. Второй провод припаиваем к любому из двух выводов.
Напряжение питания 12 вольт. Это может быть аккумулятор, выпрямитель или любой другой источник постоянного тока.
Есть тон звука схемы схемы схемы, так что вы можете экспериментировать, меняя конденсаторы и резисторы, подбирая звук, который вам нравится.
Чтобы не делать печатную плату, лучше всего брать и использовать пакетную плату, получается намного проще и быстрее.


Устанавливаем детали плотно на штыревую пластину, отделяем, проверяем еще раз и пробуем звук, подключив к источнику питания.


При правильной сборке и исправных деталях схема сразу начинает работать и в настройке не нуждается. Если вам не нравится тон, то настройте потенциометр на свой вкус.
Сигнализатор собран.


Простой музыкальный инструмент можно сделать менее чем за полчаса. Конечно, диапазон его звука, частоты и, как следствие, тембра сильно отличается от реальных профессиональных инструментов, но благодаря своей простоте он будет отличным устройством для сборки начинающего электрона.


Основа схемы хорошо известна и мегапопулярной микросхеме 555, ее периодом, а отсюда и частотой можно управлять с помощью номиналов некоторых резисторов резисторов и емкости конденсатора.


Как видите, у нас много резисторов с разным номиналом, поэтому при нажатии определенной клавиши вы превращаетесь в цепочку из резистора определенного сопротивления, и в звукоизлучающем устройстве слышен звук. Нажав другую клавишу с другим резистором, вы создадите звуковые колебания с другим тоном. При нажатии двух или более кнопок резисторы подключаются параллельно, создается другое сопротивление и звук меняется. Комбинируя эти нажатия в некоторой последовательности, вы сможете создавать примитивные мелодии – это забавно.


Для гибкой настройки рекомендую подключить переменный резистор, вращая его валом до достижения нужного тона звука, затем измерить его сопротивление измерителем, ничего не крутит, и заменить на постоянный резистор из имеющихся . Конденсатор, если найдете, можно включить обрезной, но с замером его емкости у некоторых могут возникнуть проблемы – не все мультиметры на это способны.


Особое внимание уделяется клавишам.Стандартные кнопки часов слишком жесткие, чтобы замкнуть их внутренние контакты, необходимо приложить относительно значительную силу. Мы рекомендуем их только с определенным рычагом, например, с клавишей пианино. У меня были кнопки, на нажатие которых требовалось очень мало усилий, а также длинный цилиндр для нажатия.


Путем недолговечных выходных прослушиваний с изменением угла поворота ротора переменного резистора были выбраны на мой взгляд хорошие звуковые частоты для каждой клавиши. Ниже приводится таблица частот и сопротивления резистора, подходящего для этой цели.


При желании можно легко рассчитать номиналы радиодеталей на интересующую частоту, в тех. В документации указана максимальная рабочая частота таймера 200 кГц. Человеческое ухо слышит колебания с частотой 20 Гц – 20 килогерц, так что возможности этого электронного компонента даже больше, чем нам нужно. Кратко покажите, как он рассчитывается. Первым резистором был выбран 4,7 ком – 4700 Ом. Основная формула, взятая из технической документации 555, легко отображает сопротивление R2 с помощью R1, C1 и заданной фактической частоты.


Вся плата, благодаря компонентам для поверхностного монтажа, получается крайне мала. NPN-транзистор Любой, может быть BC847, расположение его стандарта CBE, как и все биполярные транзисторы в корпусе SOT-23. Блок питания 5-18 В, но работает даже от одного литий-ионного элемента.


Также эту схему можно вставить в старый неработающий детский синтезатор мелодий. Пятый вывод микросхемы «Управление» лучше закинуть на минус через выводной конденсатор емкостью около 100 нФ.

При подключении низковольтного динамика транзистор значительно нагревается, можно это предотвратить и необходимо увеличить номинал его базового резистора или включение высокочастотных динамиков от старого телефона. В моем экземпляре так получилось, что кнопки с резисторами расположены на одной плате, а микросхема – на второй: совмещены с тонированными пластинами из жести. Кнопки лучше фиксировать не только контактами с использованием контактов, но и заливать этот футляр термогладкой или эпоксидной смолой, когда номинал на нужный звук уже выбран.

Создание схем для начинающих действительно очень сложная задача. Каждый раз приходится искать компромисс между надежностью, простотой, повторяемостью, «неубиваемостью» и, в то же время, она (схема) должна быть интересной, способной вести себя и быть информативной. Невозможно разработать устройство, которое одинаково реагировало бы на все эти качества одинаково для многолетних групп студентов. И чем они моложе, тем труднее это делать! В этой статье я хочу рассказать о конструкциях, которые с удовольствием повторяют четырехклассники.Да, новизна схемотехнических решений здесь невелика (если не сказать больше – нет). Но есть системность и надежность конструкций, их высокая повторяемость и невысокая стоимость. И не буду заморачиваться теорией, потому что для ученика четвертого класса знать: это резистор, это конденсатор, а это транзистор и у него три ножки (!!!) – уже большое достижение. По этой же причине я не дам распечатку печатной установки, так как берет плату в этом возрасте , невозможно по элементарным правилам безопасности и звуковой безопасности.Установка осуществляется прикреплением на кусок картона под руководством учителя или родителя.

«Сердцем» всех рассмотренных мною устройств будет простейший звуковой генератор, выполненный на однопроходном транзисторе Кт117 и, не сложная модернизация, мы получим разные потребительские качества.

Видео работы:

Часто такие сакэ называют «отпугивателем комаров», но кто бы выступил добровольным донором и на практике доказал бы эффективность (неэффективность) подобных устройств? Лично я предпочитаю использовать химические реактивы.Но необходимо, как-то двигая ребенка к повторению схемы! И так … мы комаров напугали!

Просто пищать не интересно. Совместимость с батареей Установите раскладку клавиш и смоделируйте работу телеграфа. И, бойтесь школьных учителей, омерзительно, тон высокий, расположение генератора в пространстве локализуется по слуху. Но когда хвастаться своим дизайном перед сверстниками, а не в классе?

Эту схему легко трансформировать в звуковой маяк.Для этого часто рекомендуется поддерживать весь генератор за счет мигающего светодиода. Это не совсем правда. Да, схема будет работать, но закрытый светодиод (он не светит) все равно пропускает ток через себя, так как у него p-N переходы включены в прямом направлении. Частота генерации схемы зависит от напряжения питания, в результате чего звук получается краном – громкий высокий тон чередуется с тихим низким. Устранить этот недостаток можно, если ввести управление миганием светодиода через вторую базу транзистора.

Видео работы:

Еще одно интересное преобразование исходной схемы можно узнать по введению тона звука генератора от подсветки. Для этого в схему следует ввести фототранзистор PTR1, управляя с его помощью однопроходным транзистором от эмиттера. Генератор становится более противным, но сколько радости у ребенка вызывает то, что звук у окна и в нутрии комнаты совсем другой!

Видео работы:

И, конечно, две тональные сирены, а как без этого? Без нее ни одной милицейской (милицейской) машине не приходилось! Для организации двухтонального звука вводим управление однопроходным транзистором эмитентом с помощью снова мигающего светодиода.Эту конструкцию будет полезно вставить в игрушечную машинку.

Видео работы:

Если есть желание построить многомоментный автомобиль с эффектами, то в качестве управляющего светодиода используется трехцветный мигающий диод, либо включаются три разных с разным свечением (красный, синий, зеленый как есть) диод. Если вы желаете увеличить громкость звука, необходимо применить любой усилитель. Частота звука Для этого динамик нужно поменять на резистор сопротивлением 100 Ом и убрать сигнал на УН.

Рассмотренные мной схемы позволяют стимулировать младших школьников к изучению самых основ радиоэлектроники, могут быть полезны в системе дополнительного образования, не содержат большого количества деталей и не вызывают затруднений при их повторении.

Эта ультразвуковая насадка предназначена для тех, у кого шумные соседи. Но обо всем по порядку. Устройство представляет собой простейший преобразователь напряжения на основе блокирующего генератора. Излучатель обслуживает пьезогловку, до него можно добраться от калькулятора, старых наручных часов, музыкальной шкатулки или игрушечного автомата, в общем думаю в каждом доме можно найти такую ​​штуку.

Трансформатор служит ферритовым кольцом от ЭБУ Блока. Блок питания и другие кольца тоже подходят практически для любого диаметра, также можно использовать W-образные трансформаторы (ферритовые) или ферритовые чашки. Трансформатор имеет две обмотки. Первичная обмотка содержит 40 витков с отводом от середины, диаметр провода тоже не критичен от 0,1 до 0,8 мм, витки протянуты по всему кольцу. Вторичная обмотка содержит 30 витков того же провода, что и первичная.

Выход вторичной обмотки напрямую подключен к пьезоголу, полярности подключения нет, работать будет по любому.Транзистор любой низкочастотный, обратной проводимости типа КТ819, КТ805, КТ829, CT817, КТ814 и все импортные аналоги, также можно использовать полевые транзисторы, которые я вам не советую, так как ток потребления будет в несколько раз больше чем использование биполярных транзисторов.

Также для энергосбережения можно использовать высокочастотные биполярные транзисторы отечественного производства например КТ315, СТ3102 или импортные аналоги С9014, 9016. Как видите, с транзисторами тоже не критично, буквально можно поставить любой, что под рукой.Источником питания самодельных ультразвуковых саке может служить – пальчиковый аккумулятор напряжением 1,5 вольта, литиевый планшет напряжением 3 вольта, аккумулятор от мобильного телефона напряжением 3,7 вольта или коронка напряжением 9 вольт. Вариант pCB для отжима показан ниже.

Теперь о главном, так что же это за устройство? Чтобы понять суть работы, стоит только включить, он издает раздражительный свист, который едва слышен, но очень действует на нервы.Основная фишка в том, что соседи не смогут понять, откуда идет звук, но для начала нужно установить это чудо в доме у шумного и надоедливого соседа. Тем не менее, я надеюсь, что вы можете согласиться и в хорошем смысле 🙂

Мощный ШИМ-регулятор для лабораторных источников питания

Схема регулятора частоты вращения двигателя постоянного тока Работает на принципах широтно-импульсной модуляции и используется для изменения частоты вращения двигателя постоянного тока на 12 вольт. Регулировка частоты вращения вала двигателя с помощью широтно-импульсной модуляции дает большую эффективность, чем использование простого изменения постоянного напряжения, подаваемого на двигатель, хотя мы также рассмотрим эти схемы

Двигатель соединен по схеме с полевым транзистором, который управляется широтно-импульсной модуляцией, реализованной на микросхеме таймера NE555, поэтому схема оказалась такой простой.


ШИМ-контроллер реализован с использованием обычного генератора импульсов на нестабильном мультивибраторе, генерирующего импульсы с частотой следования 50 Гц и построенного на популярном таймере NE555. Сигналы мультивибратора создают поле смещения на затворе полевого транзистора. Длительность положительного импульса регулируется с помощью переменного сопротивления R2. Чем больше длительность положительного импульса, поступающего на затвор полевого транзистора, тем больше мощности подается на двигатель постоянного тока.Причем за один оборот, чем короче длительность импульса, тем слабее вращается электродвигатель. Эта схема отлично работает от 12-вольтовой батареи.

Скорость двигателя 6 В может регулироваться в пределах 5-95%

Управление скоростью в этой схеме достигается путем подачи на электродвигатель импульсов напряжения различной длительности. Для этих целей используются ШИМ (широтно-импульсные модуляторы). В этом случае регулирование ширины импульса обеспечивается микроконтроллером PIC. Две кнопки SB1 и SB2, «Больше» и «Меньше», используются для управления частотой вращения двигателя.Изменить скорость вращения можно только при нажатии тумблера «Пуск». Длительность импульса в этом случае варьируется в процентах от периода от 30 до 100%.


В качестве стабилизатора напряжения для микроконтроллера PIC16F628A используется трехконтактный стабилизатор КР1158ЕН5В, имеющий низкое падение входного-выходного напряжения всего около 0,6В. Максимальное входное напряжение – 30 В. Все это позволяет использовать двигатели с напряжением от 6В до 27В. В роли переключателя питания используется составной транзистор КТ829А, который желательно установить на радиатор.

Устройство собрано на печатной плате размером 61 х 52 мм. Вы можете скачать образ печатной платы и файл прошивки по ссылке выше. (Загляните в папку архива 027-el )

Для регулирования частоты вращения маломощных электродвигателей коллекторного типа обычно используется резистор, который включается последовательно с двигателем. Но такой способ включения обеспечивает очень низкий КПД, а главное, не позволяет плавно регулировать обороты (найти переменный резистор достаточной мощности на несколько десятков Ом совсем не просто).И главный недостаток этого метода в том, что иногда ротор останавливается при понижении напряжения питания.

ШИМ-регуляторы , о которых пойдет речь в этой статье, позволяют плавно регулировать скорость без указанных выше недостатков. Кроме того, контроллеры PWM также могут использоваться для регулировки яркости ламп накаливания.

На рисунке 1 показана схема одного из этих ШИМ-регуляторов . Полевой транзистор VT1 представляет собой генератор пилообразного напряжения (с частотой повторения 150 Гц), а операционный усилитель на микросхеме DA1 работает как компаратор, формирующий сигнал ШИМ на основе транзистора VT2.Скорость регулируется переменным резистором R5, изменяющим ширину импульсов. Благодаря тому, что их амплитуда равна напряжению питания, электродвигатель не будет «тормозить», и, кроме того, можно добиться более медленного вращения, чем в нормальном режиме.


Схема контроллеров ШИМ на рис. 2 аналогична предыдущей, но задающий генератор здесь выполнен на операционном усилителе (ОУ) DA1. Этот операционный усилитель работает как генератор импульсов напряжения треугольной формы с частотой следования 500 Гц.Переменный резистор R7 позволяет плавно регулировать вращение.


На рис. 3. представлена ​​очень интересная схема регулятора. Этот ШИМ-контроллер выполнен на интегральном таймере NE555 . Частота следования задающего генератора составляет 500 Гц. Длительность импульсов, а, следовательно, и скорость вращения ротора электродвигателя можно регулировать в диапазоне от 2 до 98% от периода следования. Генератор на выходе ШИМ-контроллера на таймере NE555 соединен с усилителем тока, выполненным на транзисторе VT1 и фактически управляет электродвигателем M1.

Основным недостатком рассмотренных выше схем является отсутствие элементов стабилизации частоты вращения вала при изменении нагрузки. Но следующая диаграмма, представленная на рис. 4, поможет решить эту проблему.


Данный ШИМ-контроллер, как и большинство аналогичных устройств, имеет генератор импульсов напряжения треугольной формы (частота следования 2 кГц), выполненный на DA1.1.DA1.2, компаратор на DA1.3, электронный ключ на транзисторе VT1, а также регулятор рабочего цикла, а на самом деле скорость двигателя R6.Особенностью схемы является наличие положительной обратной связи через резисторы R12, R11, диод VD1, конденсатор С2 и DA1.4, обеспечивающую постоянную частоту вращения вала двигателя при изменении нагрузки. При подключении ШИМ-контроллера к конкретному электродвигателю с помощью резистора R12 регулируется глубина PIC, при которой нет автоколебаний скорости вращения при увеличении или уменьшении нагрузки на валу двигателя.

Элементная база. В схемах, приведенных в статье, могут использоваться следующие аналоги деталей: транзистор КТ117А можно заменить на КТ117Б-Г или, как вариант, на 2Н2646; КТ817Б – КТ815, КТ805; Микросхема К140УД7 на К140УД6, либо КР544УД1, TL071, TL081; таймер NE555 на C555, или KR1006VI1; микросхема TL074 на TL064 или TL084, LM324.Если необходимо подключить к ШИМ-контроллеру более мощную нагрузку, ключевой транзистор КТ817 необходимо заменить на более мощный полевой транзистор, как вариант, IRF3905 или аналогичный. Указанный транзистор способен передавать токи до 50А.

Эта самодельная схема может использоваться в качестве регулятора скорости для двигателя постоянного тока 12 В с номинальным током до 5 А или в качестве диммера для галогенных и светодиодных ламп 12 В с мощностью до 50 Вт. Управление осуществляется по ширине импульса. модуляция (ШИМ) с частотой следования импульсов около 200 Гц.Естественно, частоту при необходимости можно изменить, выбрав максимальную стабильность и эффективность.

Большинство таких конструкций собираются по многим. Здесь мы представляем более продвинутую версию, в которой используется таймер 7555, биполярный драйвер и мощный полевой МОП-транзистор. Эта конструкция обеспечивает улучшенное управление скоростью и работает в широком диапазоне нагрузок. Это действительно очень эффективная схема и стоимость ее деталей при покупке для самостоятельной сборки довольно низкая.

Схема использует таймер 7555 для создания переменной ширины импульса около 200 Гц.Он управляет транзистором Q3 (через транзисторы Q1 – Q2), который регулирует скорость электродвигателя или осветительных ламп.




Эта схема может питаться от 12 В во многих областях: электродвигатели, вентиляторы или лампы. Его можно использовать в автомобилях, лодках и электромобилях, в моделях железных дорог и т. Д.



Сюда также можно безопасно подключать светодиодные лампы на 12 В, например светодиодные ленты. Всем известно, что светодиодные лампы намного эффективнее галогенных или ламп накаливания, они прослужат намного дольше.А при необходимости запитать ШИМ-контроллер от 24 вольт и более, так как сама микросхема с буферным каскадом имеет регулятор мощности.

Как сделать мощный светодиодный фонарик своими руками. Самодельный фонарик из светодиодной ленты и дохлого аккумулятора отвертки. Причины использования светодиодов

В последнее время слово LED ассоциировалось только с индикаторными устройствами. Поскольку они были довольно дорогими и излучали всего несколько цветов, они также слабо светились. С развитием технологий цена на светодиодную продукцию постепенно снижалась, сфера применения расширялась широкими ступенями.

Сегодня они используются в различных устройствах, применяются практически везде, где необходимы осветительные приборы. Фары и лампы в автомобилях оснащены светодиодами, на рекламных щитах выделяются светодиодные ленты … В бытовых условиях они также используются не реже.

Причины использования светодиодов

Не обошлось и без фонарей

. Благодаря мощным светодиодам удалось собрать сверхмощный и в то же время достаточно автономный фонарь.Такие огни могут излучать очень сильный и яркий свет на большие расстояния или большие площади.

В этой статье мы расскажем вам об основных преимуществах светодиодов большой мощности, а также покажем, как сложить светодиодный фонарик своими руками. Если вы уже сталкивались с этим, то можете дополнить свои знания, для новичков в этой области статья ответит на многие вопросы, связанные со светодиодами и фонариками с их использованием.

Если вы хотите сэкономить деньги с помощью светодиода, следует учитывать несколько факторов.Поскольку иногда цена на такую ​​лампу может превышать всю экономию. Если на обслуживание источников света приходится тратить много денег и времени, а общее их количество потребляет много электроэнергии, то стоит подумать, не станет ли светодиод лучшей заменой.

По сравнению с обычными светильниками, светодиод имеет ряд преимуществ, которые его возвышают:

  • Нет необходимости в обслуживании.
  • Значительная экономия энергии, иногда до 10 раз.
  • Высококачественный световой поток.
  • Очень долгий срок службы.

Необходимые компоненты

Если вы решили собрать светодиодный фонарик своими руками, для передвижения в темноте или для работы ночью, но не знаете с чего начать? Мы поможем вам в этом. Первым делом необходимо найти необходимые детали для сборки.

Вот предварительный перечень необходимых запчастей:

  1. Светодиод
  2. Обмоточный провод, 20-30 см.
  3. Ферритовое кольцо диаметром примерно 1-1,5 см.
  4. Транзистор.
  5. резистор 1000 Ом.

Конечно, этот список тоже нужно дополнить аккумулятором, но это элемент, который легко найти в любом доме и не требует специальной подготовки. Также следует выбрать корпус или какое-то основание, на которое будет установлена ​​вся схема. Хорошим корпусом может быть старый неработающий фонарик или тот, который вы собираетесь переделать.

Как собрать своими руками

При сборке схемы нам понадобится трансформатор, но его не добавили в список. Сделаем его своими руками из ферритового кольца и проволоки. Сделать это очень просто, берем наше кольцо и начинаем наматывать провод сорок пять раз, этот провод подключится к светодиоду. Берем следующий провод, уже раз тридцать наматываем, и отправляем на базу транзистора.

Используемый в цепи резистор должен иметь сопротивление 2000 Ом, только при использовании этого сопротивления схема может работать без сбоев.При тестировании схемы замените резистор R1 на аналогичный, с регулируемым сопротивлением. Включите всю схему и отрегулируйте сопротивление этого резистора, отрегулируйте напряжение примерно до 25 мА.

В результате вы узнаете, какое сопротивление должно быть в этот момент, и сможете выбрать подходящий резистор с требуемым значением сопротивления.

Если схема составлена ​​в полном соответствии с вышеперечисленными требованиями, то фонарик должен работать сразу.Если это не сработает, возможно, вы сделали следующую ошибку:

  • Концы обмотки соединены в обратном порядке.
  • Количество витков не соответствует требуемому.
  • Если намотка меньше 15, то генерация тока в трансформаторе перестает осуществляться.

Собираем светодиодный фонарик на 12 В

Если света от фонарика недостаточно, то можно собрать мощный фонарик с питанием от аккумулятора на 12 вольт.Такой фонарик еще портативный, но уже по размеру намного больше.

Для сборки схемы такого фонаря своими руками нам потребуются следующие детали:

  1. Пластиковая труба диаметром около 5 см с клеем из ПВХ.
  2. Фитинг для ПВХ, две штуки.
  3. Заглушка с резьбой.
  4. Тумблер.
  5. Собственно сама светодиодная лампа, рассчитанная на 12 вольт.
  6. Батарея для питания светодиодов, 12 вольт.

Изолента, термоусадочная трубка и маленькие зажимы для очистки проводки.
Батарейку можно сделать своими руками, из батареек, которые используются в радиоуправляемых игрушках. В зависимости от мощности может потребоваться 8-12 шт., Чтобы в сумме получилось 12 вольт.

Припаяйте два провода к контактам на лампочке, длина каждого должна превышать длину батареи на несколько сантиметров. Все тщательно утеплены. При подключении лампы к аккумулятору установите тумблер так, чтобы он находился на противоположном конце от светодиодной лампы.

На концах проводов, идущих от лампы и от аккумуляторного блока, который мы сделали своими руками, устанавливаются специальные разъемы для удобного подключения.Собираем всю схему и проверяем ее работоспособность.

Схема сборки

Если все работает, то приступаем к созданию корпуса. Отрезав трубу необходимой длины, вставляем в нее всю нашу конструкцию. Аккумулятор Аккуратно закрепляем изнутри клеем, чтобы не повредить лампочку в процессе работы.

Устанавливаем с обоих концов фурнитуру, фиксируем клеем, таким образом предохраняем фонарь от случайного попадания влаги внутрь. Далее подносим наш тумблер к противоположному от лампы краю, а также аккуратно фиксируем.Задний штуцер должен полностью закрывать выключатель своими стенками, а при ввинчивании вилки не допускать попадания туда влаги.

Для использования достаточно открутить колпачок, включить фонарик и снова затянуть.

Ценовой вопрос

Самое дорогое, что вам понадобится, – это светодиодная лампа на 12 вольт. Стоит около 4-5 долларов. Копаясь в старых детских игрушках, батарейки от разбитой машины будут для вас бесплатными.

Тумблер и трубу тоже можно найти в гараже, обрезки таких труб постоянно остаются после ремонта.Если нет труб и батареек, можно спросить у друзей и соседей или купить в магазине. Если покупать абсолютно все, то такой фонарик может стоить около 10 долларов.

Суммировать

Светодиодная технология

набирает все большую популярность. Обладая хорошими характеристиками, вскоре они могут полностью заменить всех конкурентов в области освещения. А собрать мощный портативный фонарик со светодиодной лампой самостоятельно вам не составит труда.

Вопрос экономии электроэнергии сегодня как никогда актуален.Лампы накаливания потребляют много электроэнергии, но не всегда обеспечивают достаточное освещение. На смену им пришли светодиодные уличные фонари, светильники для дома и автомобиля. Читайте дальше, чтобы узнать, как самому сделать светодиодный фонарик.

Приборов:

  • лупа;
  • паяльник;
  • ножницы или нож;
  • фонарь старый.

Материалы:

  • диода;
  • фольга;
  • конденсатор;
  • трансформатор;
  • нефритовое кольцо;
  • батарейки или аккумуляторы;
  • транзистор;

Один из самых простых способов сделать светодиодную лампу – использовать старый нерабочий корпус и установить в него отдельные светодиоды.Это позволяет без дополнительных усилий делать светодиодные фонари своими руками. Но когда работа выполняется с нуля, приходится работать более аккуратно и ответственно. Предлагаем вашему вниманию сразу три схемы, по которым можно сделать мощный и экономичный диодный фонарь. В каждой из предложенных схем рекомендуем использовать светодиоды мощностью 3 Вт. Вы можете выбрать цвет свечения на свое усмотрение (теплый или холодный). Но для дома более приятным будет теплый цвет, придавая помещению пастельные тона.На улице лучше использовать холодный – он будет немного ярче.

Схема светодиодного фонаря №1

В диапазоне 3,7-14 вольт эта схема показывает отличную стабильность в работе. Обратите внимание, что эффективность может упасть с ростом напряжения. Выходное напряжение можно отрегулировать до 3,7 и поддерживать во всем диапазоне. Установите выходное напряжение резистором R3, но не уменьшайте его слишком сильно. Необходимо рассчитать максимальный ток на LED1-LED, а также максимально допустимое напряжение на LED2.Если ваш фонарик питается от литий-ионного аккумулятора, эффективность составит 90-95%. 4,2 вольта обеспечивают КПД 90%. 3,8 – 95%. Вы можете рассчитать это по простой формуле: P = U x I.

Выбранный светодиод потребляет 0,7 А при 3,7 В. Делаем просчет: 0,7 х 3,7 = 2,59 Вт. Из полученного числа вычитаем напряжение аккумулятора и умножаем на потребляемый ток: (4,2 – 3,7) х 0,7 = 0,35 Вт. И теперь вы легко можете узнать точный КПД: (100 / (2,59 + 0,37)) х 2,59 = 87.5%.

На радиатор необходимо установить мощные светодиоды. Его можно взять из питания компьютерного блока.

Можно использовать следующую расстановку деталей:

Обратите внимание, что транзистор не касается платы. Действуйте следующим образом:

  1. Вставьте кусок толстой бумаги между резистором и платой или нарисуйте схему платы.
  2. Сделайте так же, как и на лицевой стороне листа.
  3. Для питания ноутбука можно использовать две батареи.Также можно взять батарейки для телефона. Главное, чтобы в сумме они давали ток не менее 5 мАч.
  4. Подключите батареи или аккумуляторы параллельно.

Схема светодиодной лампы №2

Второй вариант достаточно экономичный. Вам понадобятся KT819, KT315 и KT361. С их помощью можно сделать хороший стабилизатор, хотя потери будут немного больше, чем в предыдущем варианте. Схема довольно похожа на первую, но все сделано с точностью до наоборот.Напряжение подается конденсатором С4. Основное отличие состоит в том, что выходной транзистор открывается резисторами R1 и КТ315. В первой схеме закрывается и открывается только КТ315.

Все детали должны быть расположены следующим образом:

Дополнительный светодиод одновременно обеспечивает хорошую стабилизацию. Следующая информация поможет вам разработать другие регуляторы низкого напряжения.

  1. Температурная стабилизация. Если у вас есть опыт и знания в области электроники, то вы понимаете, что это важный момент, если фонарик будет использоваться на улице в разное время года и в разных условиях.В описанных выше схемах все происходит по следующей системе: при повышении температуры канал проводника расширяется, позволяя пройти заметно большему количеству электронов. При этом его сопротивление уменьшается, а пропускаемый ток увеличивается. Из-за этого сам светодиод тоже увеличивает и закрывает транзисторы, тем самым стабилизируя работу. Такая схема полностью работает без сбоев при температуре от -20 до +50 градусов. Этого более чем достаточно.Можно встретить и другие схемы, но часто даже при небольшом повышении температуры происходит сбой стабилизации, из-за чего диоды сразу перегорают.
  2. Светодиод. Устройство светодиодного фонарика этого типа подразумевает, что с увеличением напряжения вместе с ним увеличивается и потребляемый ток. Транзистор в этом случае намного лучше реагирует на небольшие изменения напряжения, чем обычный резисторный усилитель. Кроме того, это требует высокой степени усиления. Это значительно сокращает количество используемых деталей и, следовательно, экономит время и деньги.

Схема светодиодного фонаря №3

Последняя рассмотренная схема позволяет значительно повысить КПД, получить более высокую яркость свечения. В этом случае вам понадобятся четыре аккумулятора общей емкостью не менее 13 Ач и дополнительная линза для фокусировки светодиодов.

В этом случае дополнительный светодиод не требуется. Все выполнено в SMD-конструкции без транзисторов, потребляющих дополнительную энергию. Благодаря этому срок автономной работы значительно увеличивается.Стабилизатор может быть TL431. В этом случае КПД может варьироваться от 90 до 99 процентов, что более чем хорошо.

На выходе лучше всего поставить питание 3,9 вольта. При этом светодиоды не перегорят долгие месяцы, а то и годы. Хотя небольшой нагрев радиатора вполне возможен. Но это нормально.

Сделать фонарик от 1.5V

Если вам не нужно разбираться в сложных схемах, чтобы получить мощный осветительный прибор, мы также предлагаем простой способ сделать самые простые (хотя и довольно слабые) светодиодные светильники для вашего дома.Этого фонарика достаточно для домашнего использования.

Чтобы упростить задачу, вы можете взять старый фонарь накаливания и поработать с ним. Порядок действий следующий:

  1. Возьмите нефритовое кольцо и обмотайте его проволокой толщиной до 0,5 мм. Обязательно сделайте петлю или загните в сторону.
  2. Соединяем трансформатор, транзистор и светодиод вместе. Чтобы получить более яркий свет, можно установить дополнительный конденсатор. Но это необязательно.
  3. Проверьте, горит ли светодиод. Если нет, то причиной может быть неправильная полярность аккумулятора, неправильное подключение транзистора и непосредственно светодиода.Не расстраивайтесь, если схема не сработает с первого раза.
  4. Чтобы светодиод светился ярче, используйте конденсатор С1.
  5. Установить переменный резистор вместо постоянного (подойдет 1,5 кОм) и покрутить. Когда вы найдете положение, при котором диод начинает светиться ярче, зафиксируйте положение.

Когда схема готова, диод светит максимальной яркостью и все работает, можно приступать к отделочным работам.

  1. Измерьте диаметр трубки фонарика и вырежьте вокруг нее круг из стекловолокна.
  2. Найдите нужные детали подходящего размера и номинала.
  3. Раскладываем доску, ножом разрезаем фольгу и прикрепляем к кругу.
  4. Для пайки платы лучше всего использовать паяльник со специальным наконечником. Если его нет, можно просто обернуть зачищенный провод вокруг паяльника так, чтобы один конец выступал вперед. Именно с ними вы и будете работать.
  5. Припаяйте детали вместе со светодиодом, конденсатором и трансформатором к плате. Вначале можно немного припаять, чтобы проверить работоспособность.Если все работает нормально, припаяйте полностью.
  6. Когда все заработало и крепко держится, можно вставить получившуюся плату в трубку фонарика. Если заходит без проблем, то края круга вскройте лаком. Это нужно для того, чтобы не было контакта, ведь сам корпус в этом случае – минус.

Изготовленный фонарь может полноценно и долго работать даже при разряженном аккумуляторе. Если батареи нет вообще, то лампочка загорится даже от нестандартной батареи.Например, если вставить в картошку два провода из разных металлов и подключить светодиод. Не факт, что вам понадобится этот способ, но случаи бывают разные.

Светодиодные фонари

получили хорошие отзывы покупателей за счет низкого энергопотребления, невысокой стоимости и надежности. Лампы накаливания – далеко не лучший вариант на сегодняшний день. А теперь вы знаете, как сделать светодиодный фонарик своими руками из подручных средств.

Необходимо включить ближний свет фар или дневные ходовые огни… Стандартные фары большинства автомобилей в основном содержат лампы накаливания, плюс габаритные задние фонари – в результате мы получаем энергопотребление от аккумулятора и генератора порядка 150-300Вт. Но ничего не происходит даром – это приводит к ненужному расходу бензина, к преждевременному выходу из строя ламп накаливания автомобиля, то есть к дополнительным затратам и потере времени на ремонт.

Дневные ходовые огни выделяют автомобиль на дороге и являются хорошим дополнением к любому транспортному средству.Однако цена на брендовые ДХО в наших магазинах обычно довольно высока. Попробуем изготовить сами, тем более что цены на материалы будут минимальными.

Пробовал разные варианты ДХО. Но всегда что-то не устраивало, светодиоды часто перегорали, потом светорассеивающая фурнитура быстро теряла прозрачность от грязи и песка и т. Д. Но тут под мышкой оказался налобный фонарь из магазина Fix Price за смешную цену 50 руб. У него оказался хороший зеркальный отражатель и небольшие габариты.Ради эксперимента было решено его модернизировать. Переделанный фонарь можно использовать как в режиме ДХО, так и как мощный фонарь в гараже, кемпинге и т. Д.

Посмотреть процесс изготовления самоделок можно в видео:

Перечень инструментов и материалов
– фара;
– отвертка;
– паяльник;
-тестер;
– блок питания 12В;
– светодиод белый 1W-7 шт .;
– диоды выпрямительные 1А-4шт;
– текстолит двусторонний фольгированный;
-термопаста;
– герметик силиконовый;
– листовая латунь или медь металлическая 0.Толщина 3 мм.

Шаг первый. Демонтаж фонаря.
Разбираем фонарь на комплектующие. Отсоедините светодиодную плату от батарейного отсека. Кстати, из этого аккумуляторного отсека можно сделать павербанк, добавив плату зарядки аккумулятора. Но теперь нам понадобится только корпус фонаря с рефлектором и стеклом.


Шаг второй. Изготовление печатной платы, радиаторов, монтаж фонаря.
Изготавливаем печатную плату из фольгированной двусторонней PCB размером 45х45мм. Резаком делаем дорожки для двух групп светодиодов. Первая группа – на четыре светодиода, вторая – на три.


Затем с помощью термопасты устанавливаем светодиоды на печатную плату и припаиваем их согласно схеме ниже.


Дополнительные диоды используются для выравнивания напряжения в группе из трех светодиодов. Они припаяны к плате и защищены термоусадкой.Сбросил эти диоды с неисправной электронной платы энергосберегающей лампы.

С обратной стороны На печатную плату припаиваем латунные полоски, которые предназначены для отвода тепла, выделяемого светодиодами. Накладываем стекло фонаря на силиконовый герметик. Крепим отражатель к печатной плате и собираем фонарь. Латунные полоски вынимаются из корпуса фонаря через прорези и снаружи складываются гармошкой. Также обрабатываем резьбовое соединение герметиком.Провода питания выводятся в отверстие в корпусе лампы через резиновую уплотнительную трубку. К поворотному зажиму прикручиваем самодельный металлический кронштейн для крепления к автомобилю.

Шаг третий. Тестирование переделанного фонаря.
Подключаем переделанный фонарь к источнику питания.



Сравнительное фото до переделки.


Как видно на фотографиях, результат хороший. При изменении напряжения питания резко меняется ток через светодиоды.При 12 вольт-0,25 ампер, 13 вольт-0,48 ампер, 13,4 вольт-0,62 ампер. Максимальный ток для этих светодиодов мощностью 1 Вт составляет 0,3 ампера. В лампе две группы светодиодов, поэтому я решил увеличить срок службы светодиодов, общий ток должен быть в пределах 0,5 ампера. В электросети автомобиля напряжение может колебаться от 12 вольт до 15 вольт, а это значит, что при подключении в режиме ДХО желательно добавить стабилизатор тока на микросхему LM317.


Стабилизатор тока собран на алюминиевом радиаторе и установлен в распределительной коробке вместе с клеммной колодкой и промежуточным реле.Рядом с автомобильным аккумулятором установил распределительную коробку с заливкой. Реле подает напряжение при запуске двигателя. Катушка реле подключена к нити накала лампы габаритного света и цепи питания топливного насоса. Таким образом, реле включается только при работающем двигателе и выключенных габаритах и ​​фарах. Предлагаю на ваше усмотрение три варианта схем мощных светодиодных фонарей, которыми пользуюсь давно, и лично меня вполне устраивает яркость свечения и продолжительность работы (в реальной жизни, одного заряда мне хватает на месяц использования – то есть ходил, рубил дрова или куда-то ходил).Светодиод используется во всех схемах мощностью 3 Вт. С разницей только в цвете свечения (теплый белый или холодный белый), но лично мне кажется, что холодный белый светит ярче, а теплый белый приятнее читать, то есть он легко воспринимается глазами, так что выбор за вами.

Первая версия схемы фонарика

На тестах эта схема показала невероятную стабильность в диапазоне напряжений питания 3,7-14 вольт (но учтите, что при повышении напряжения КПД падает).Так как на выходе я настроил 3,7 вольта, то это было во всем диапазоне напряжений (выходное напряжение задается резистором R3, при уменьшении этого сопротивления выходное напряжение увеличивается, но не советую слишком сильно его уменьшать, если экспериментируете, рассчитываете максимальный ток на LED1 и максимальное напряжение на втором) … Если запитать эту схему от Li-ion аккумуляторов, то КПД примерно равен 87-95%. Спросите, а зачем тогда ШИМ придумали? Если не верите, посчитайте.

При 4,2 В КПД = 87%. При 3,8 В КПД = 95%. P = U * I

Светодиод потребляет 0,7 А при 3,7 В, что означает 0,7 * 3,7 = 2,59 Вт, вычтите напряжение заряженной батареи и умножьте его на потребление тока: (4,2 – 3,7) * 0,7 = 0,35 Вт. Теперь узнаем КПД: (100 / (2,59 + 0,37)) * 2,59 = 87,5%. И полпроцента на нагрев остальных деталей и гусениц. Конденсатор C2 – плавный пуск для безопасного включения светодиода и защиты от помех.Обязательно установите на радиатор мощный светодиод, я использовал один радиатор от компьютерного блока питания. Вариант расположения деталей:


Выходной транзистор не должен касаться задней металлической стенкой платы, просовывать между ними бумагу или рисовать рисунок платы на листе тетради и делать это так, как на другой стороне платы. простыня. Для питания светодиодного фонарика я использовал два Li-ion аккумулятора от аккумулятора ноутбука, но вполне можно использовать телефонные аккумуляторы, желательно, чтобы их суммарный ток был 5-10А * ч (подключаем параллельно).

Перейдем ко второй версии диодного фонаря

Я продал первый фонарик и почувствовал, что ночью без него немного напрягает, и нет деталей, чтобы повторить предыдущую схему, поэтому Пришлось импровизировать из того, что было на тот момент, а именно: КТ819, КТ315 и КТ361. Да, даже на таких деталях можно собрать низковольтный стабилизатор, но с чуть большими потерями. Схема похожа на предыдущую, но в этой все наоборот.Сюда же плавно подает напряжение конденсатор С4. Разница в том, что здесь выходной транзистор открывается резистором R1, а КТ315 закрывает его до определенного напряжения, а в предыдущей схеме выходной транзистор закрыт и открывается вторым. Вариант расположения деталей:

Я использовал его около полугода, пока линза не треснула, повредив контакты внутри светодиода. Он еще работал, но только в трех камерах из шести. Поэтому оставил в подарок 🙂 Теперь расскажу, почему такая хорошая стабилизация с использованием дополнительного светодиода.Кому интересно читать, может пригодиться при проектировании низковольтных стабилизаторов или пропустить и перейти к последнему варианту.

Итак, начнем со стабилизации температуры, кто проводил эксперименты, знает, насколько это важно зимой или летом. Итак, в этих двух мощных фонариках есть такая система: при повышении температуры полупроводниковый канал увеличивается, пропуская больше электронов, чем обычно, поэтому кажется, что сопротивление канала уменьшается и, следовательно, пропускаемый ток увеличивается, поскольку та же система работает на у всех полупроводников ток через светодиод тоже увеличивается, закрывая все транзисторы до определенного уровня, то есть напряжения стабилизации (эксперименты проводились в диапазоне температур -21… + 50 градусов по Цельсию). Собрал в интернете множество схем стабилизаторов и задумался, «как же можно допускать такие ошибки!» Кто-то даже рекомендовал свою схему питания лазера, при которой повышение температуры на 5 градусов готовило лазер к излучению, так что учтите этот нюанс!

Теперь про сам светодиод. Любой, кто играл с напряжением питания светодиодов, знает, что при его повышении резко возрастает потребление тока. Поэтому при небольшом изменении выходного напряжения стабилизатора транзистор (КТ361) реагирует во много раз легче, чем с простым резистивным делителем (для которого требуется серьезное усиление), что решает все проблемы низковольтных стабилизаторов. и уменьшает количество деталей.

Третий вариант светодиодного фонарика

Перейдем к последней схеме, рассмотренной и используемой мной по сей день. КПД выше, чем в предыдущих схемах, и яркость свечения выше, ну и, конечно, я купил дополнительную линзу фокусировки для светодиода, а батарейки уже 4, что примерно равно емкости 14А * часы. Принципиальная электронная схема:

Схема достаточно простая и собрана в SMD-исполнении, нет дополнительных светодиодов и транзисторов, потребляющих избыточный ток.Для стабилизации использовался TL431 и этого вполне достаточно, КПД здесь от 88 – 99%, если не верите, просто сосчитайте. Фото готового самодельного девайса:


Да, кстати по поводу яркости, здесь я допустил 3,9 вольта на выходе схемы и уже больше года пользуюсь, светодиод стоит еще жив, только радиатор немного греется. Но кто желает может выставить себе меньшее напряжение питания, подобрав выходные резисторы R2 и R3 (советую сделать это на лампе накаливания, при получении желаемого результата подключите светодиод).Спасибо за внимание, с вами был Левша Леша (Алексей Степанов).

Обсудить статью МОЩНЫЕ СВЕТОДИОДНЫЕ ФОНАРИ


Фонарь светодиодный своими руками

Фонарь светодиодный с преобразователем 3 вольта на светодиоды 0,3-1,5В 0,3-1,5 V LED FlashLight

Обычно для работы синего или белого светодиода требуется 3 – 3,5 В, эта схема позволяет запитать синий или белый светодиод низкого напряжения от одной пальчиковой батареи. вы хотите зажечь синий или белый светодиод, вам нужно предоставить ему 3 – 3.5 В, как от литиевого аккумуляторного элемента на 3 В.

Детали:
Светодиод
Ферритовое кольцо (диаметр ~ 10 мм)
Обмотка (20 см)
Резистор 1 кОм
Транзистор NPN
Батарея

Параметры используемого трансформатора:
Обмотка, идущая к светодиоду, имеет ~ 45 витков, намотаны проводом 0,25 мм.
Обмотка, идущая к базе транзистора, имеет ~ 30 витков провода 0,1 мм.
Базовый резистор в этом случае имеет сопротивление около 2 кОм.
Вместо R1 желательно поставить подстроечный резистор, и добиться тока через диод ~ 22мА, при свежем аккумуляторе измерить его сопротивление, после чего заменить на постоянный резистор полученного номинала.

Собранная схема должна сразу заработать.
Есть только 2 возможных причины, по которым схема не работает.
1. концы обмотки перевернуты.
2. Слишком мало витков основной обмотки.
Генерация пропадает при количестве витков

Соедините куски проводов и намотайте их на кольцо.
Соедините два конца разных проводов вместе.
Схема может быть размещена внутри подходящего корпуса.
Внедрение такой схемы в фонарик с питанием от 3В значительно продлевает время его работы от одного комплекта батареек.


Вариант фонарика от одной батарейки 1.5в.


Транзистор и сопротивление размещены внутри ферритового кольца



Белый светодиод питается от разряженной батареи AAA

Вариант модернизации фонарика и ручки

Возбуждение блокирующего генератора показано на рисунке диаграмма достигается за счет трансформаторной связи на Т1. Импульсы напряжения, возникающие в правой (по схеме) обмотке, складываются с напряжением источника питания и поступают на светодиод VD1.Конечно, можно было бы исключить конденсатор и резистор в цепи базы транзистора, но тогда VT1 и VD1 могут выйти из строя при использовании фирменных аккумуляторов с низким внутренним сопротивлением. Резистор устанавливает режим работы транзистора, а конденсатор пропускает ВЧ компонент.

В схеме использован транзистор КТ315 (как самый дешевый, но можно использовать и любой другой с частотой среза 200 МГц), сверхъяркий светодиод. Для изготовления трансформатора потребуется ферритовое кольцо (примерный размер 10х6х3 и проницаемость около 1000 HH).Диаметр проволоки около 0,2-0,3 мм. На кольцо намотаны две катушки по 20 витков каждая.
Если кольца нет, то можно использовать цилиндр того же объема и материала. Вам нужно всего лишь намотать 60-100 витков на каждую из катушек.
Важный момент: катушки нужно наматывать в разные стороны.

Фото фонарика:
переключатель находится в кнопке «ручка», а серый металлический цилиндр проводит ток.

Делаем цилиндр по размеру аккумулятора.

Может быть бумажным или отрезком любой жесткой трубки.
Проделываем отверстия по краям цилиндра, обматываем луженой проволокой, продеваем концы проволоки в отверстия. Закрепляем оба конца, но на одном из концов оставляем кусок проводника: чтобы можно было соединить преобразователь со спиралью.
Ферритовое кольцо не помещалось в фонарь, поэтому был использован цилиндр из того же материала.


Цилиндр из индуктора от старого телевизора.
Первая катушка примерно 60 витков.
Потом второй, снова в обратном направлении, 60 или около того. Катушки скрепляются клеем.

Собираем преобразователь:

Все находится внутри нашего корпуса: Припаиваем транзистор, конденсатор, резистор, припаиваем спираль на цилиндр, катушку. Ток в обмотках катушки должен идти в разные стороны! То есть, если намотать все обмотки в одну сторону, то поменять местами выводы одной из них, иначе генерации не произойдет.

Получилось следующее:


Вставляем все внутрь, а гайки используем как боковые заглушки и контакты.
К одной из гаек припаиваем выводы катушки, а к другой эмиттер VT1. Склеиваем. отмечаем выводы: где у нас будет вывод с катушек ставим «-», где вывод с транзистора с катушкой «+» (чтобы все было как в батарее).

Теперь необходимо сделать “ламповый диод”.


Внимание: на цоколе должен быть минусовой светодиод.

Сборка:

Как видно из рисунка, преобразователь является «заменой» второй АКБ. Но в отличие от него имеет три точки соприкосновения: с плюсом батареи, с плюсом светодиода и общим корпусом (через спираль).

Его расположение в батарейном отсеке однозначно: он должен контактировать с плюсом светодиода.

Современный фонарик с режимом работы блока питания светодиодов с постоянным стабилизированным током.


Схема регулятора тока работает следующим образом:
При подаче питания на схему транзисторы T1 и T2 заблокированы, T3 открыт, поскольку на его затвор через резистор R3 подается напряжение разблокировки.Благодаря наличию в цепи светодиода дросселя L1 ток плавно нарастает. По мере увеличения тока в цепи светодиода падение напряжения на цепи R5-R4 увеличивается, как только оно достигает примерно 0,4 В, открывается транзистор T2, а затем транзистор T1, который, в свою очередь, замыкает переключатель тока T3. Нарастание тока прекращается, в дросселе возникает ток самоиндукции, который начинает течь через диод D1 через светодиод и цепочку резисторов R5-R4. Как только ток упадет ниже определенного порога, транзисторы T1 и T2 закроются, T3 откроются, что приведет к новому циклу накопления энергии в катушке индуктивности.В штатном режиме колебательный процесс происходит с частотой порядка десятков килогерц.

О реквизитах :
Вместо транзистора IRF510 можно использовать IRF530 или любой n-канальный полевой транзистор на ток более 3 А и напряжение более 30 В.
Диод D1 обязательно должен быть с барьером Шоттки для ток более 1А, если поставить обычный даже высокочастотный типа КД212, КПД снизится до 75-80%.
Катушка индуктивности самодельная, намотана проводом не тоньше 0.6 мм, желательно пучком из нескольких более тонких проводов. Около 20-30 витков провода на армированном сердечнике В16-В18 обязательно с немагнитным зазором 0,1-0,2 мм или аналогичным из феррита 2000НМ. По возможности, толщина немагнитного зазора подбирается экспериментально по максимальной эффективности устройства. Хорошие результаты можно получить с ферритами от импортных катушек индуктивности, устанавливаемых в импульсных источниках питания, а также в энергосберегающих лампах. Такие сердечники имеют форму катушки с резьбой, не требуют рамки и немагнитного зазора.Катушки с тороидальным сердечником из экструдированного порошка железа, которые используются в источниках питания компьютеров (на которые намотаны катушки индуктивности выходного фильтра), работают очень хорошо. Немагнитный зазор в таких сердечниках равномерно распределен в объеме за счет технологии производства.
Эту же схему стабилизатора можно использовать вместе с другими аккумуляторами и батареями гальванических элементов с напряжением 9 или 12 вольт без изменения схемы или номиналов элементов. Чем выше напряжение питания, тем меньше тока будет потреблять фонарь от источника, его КПД останется неизменным.Рабочий ток стабилизации задается резисторами R4 и R5.
При необходимости ток можно увеличить до 1А без использования радиаторов на деталях, только подбором сопротивления управляющих резисторов.
Зарядное устройство для аккумулятора можно оставить «родным» или собрать по любой из известных схем, а также использовать внешнее, чтобы уменьшить вес фонарика.

Светодиодный фонарик от вычислителя Б3-30

Преобразователь построен на схеме вычислителя Б3-30, в импульсном источнике питания которой используется трансформатор толщиной всего 5 мм и двумя обмотками.Использование импульсного трансформатора от старого калькулятора позволило создать экономичный светодиодный фонарик.

В результате получается очень простая схема.

Преобразователь напряжения выполнен по схеме однотактного генератора с индуктивной обратной связью на транзисторе VT1 и трансформаторе Т1. Импульсное напряжение с обмотки 1-2 (согласно принципиальной схеме вычислителя В3-30) выпрямляется диодом VD1 и подается на сверхяркий светодиод HL1. Конденсаторный фильтр С3.В основе конструкции фонарь китайского производства, рассчитанный на установку двух батареек АА. Преобразователь установлен на печатной плате из одностороннего фольгированного стеклотекстолита толщиной 1,5 мм. рис. 2 габаритов, заменяющих одну батарейку и вставляемых в фонарик вместо нее. К концу платы, отмеченному знаком «+», припаивается контакт из двухстороннего фольгированного стеклотекстолита диаметром 15 мм, обе стороны соединяются перемычкой и покрываются припоем.
После установки всех деталей на плату концевой контакт «+» и трансформатор Т1 заполняются термоклеем для повышения прочности. Вариант компоновки фонаря показан на рис. рис. 3 и в конкретном случае зависит от типа используемого фонарика. В моем случае доработки фонаря не потребовалось, на отражателе есть контактное кольцо, к которому припаивается отрицательный вывод печатной платы, а сама плата крепится к отражателю термоклеем.Печатная плата с отражателем вставляется вместо одной батареи и зажимается крышкой.

В преобразователе напряжения используются мелкие детали. Резисторы типа МЛТ-0,125, конденсаторы С1 и С3 импортные, высотой до 5 мм. Диод VD1 типа 1N5817 с барьером Шоттки, при его отсутствии можно использовать любой подходящий по параметрам выпрямительный диод, желательно германиевый за счет меньшего падения напряжения на нем. Правильно собранный преобразователь не требует регулировки, если обмотки трансформатора не перевернуты, в противном случае поменяйте местами.При отсутствии вышеуказанного трансформатора его можно изготовить самостоятельно. Намотка осуществляется на ферритовом кольце типоразмера К10 * 6 * 3 с магнитной проницаемостью 1000-2000. Обе обмотки намотаны проводом ПЭВ2 диаметром от 0,31 до 0,44 мм. Первичная обмотка имеет 6 витков, вторичная – 10 витков. После установки такого трансформатора на плату и проверки его работоспособности следует закрепить на нем термоклеем.
Испытания фонаря с батареей типа АА представлены в таблице 1.
При тестировании использовалась самая дешевая батарейка АА стоимостью всего 3 рубля. Начальное напряжение под нагрузкой составляло 1,28 В. На выходе преобразователя напряжение, измеренное на сверхъярком светодиоде 2,83 В. Марка светодиода неизвестна, диаметр 10 мм. Общий потребляемый ток 14 мА. Общее время работы фонаря составило 20 часов непрерывной работы.
При падении напряжения на АКБ ниже 1В яркость заметно падает.

Аккумулятор
Время, ч В, В В пер., В
0 1,28 2,83
2 1,22 2,83
4 1,21 2,83
6 1,20 2,83
8 1,18 2,83
10 1,18 2,83
12 1,16 2.82
14 1,12 2,81
16 1,11 2,81
18 1,11 2,81
20 1,10 2,80

Самодельный светодиодный фонарь

Основа – фонарь VARTA с питанием от двух батареек АА:
Поскольку диоды имеют сильно нелинейную ВАХ, необходимо оборудовать фонарик схемой для работы со светодиодами, которая будет обеспечивать постоянную яркость свечения при разряде аккумулятора и будет продолжать работать при минимально возможном напряжении питания.
Основой регулятора напряжения является повышающий DC / DC преобразователь Micropower MAX756.
По заявленным характеристикам работает при понижении входного напряжения до 0,7В.

Схема подключения – типовая:

Монтаж осуществляется навесным способом.
Конденсаторы электролитические – танталовые ЧИП. У них низкое последовательное сопротивление, что немного повышает КПД. Диод Шоттки – SM5818. Дроссели пришлось подключать параллельно, так как подходящего номинала не было.Конденсатор С2 – К10-17б. Светодиоды – сверхъяркие белые L-53PWC “Kingbright”.
Как видно на рисунке, вся схема легко помещается в пустое пространство светоизлучающего блока.

Выходное напряжение стабилизатора в этой схеме переключения составляет 3,3 В. Поскольку падение напряжения на диодах в диапазоне номинального тока (15–30 мА) составляет около 3,1 В, дополнительные 200 мВ приходилось гасить на резисторе, подключенном последовательно с выходом.
Кроме того, небольшой последовательный резистор улучшает линейность нагрузки и стабильность схемы.Это связано с тем, что диод имеет отрицательную ТКС, и при нагреве на нем уменьшается прямое падение напряжения, что приводит к резкому увеличению тока через диод при его питании от источника напряжения. Уравнивать токи через параллельно включенные диоды не пришлось – разницы в яркости на глаз не наблюдалось. Причем диоды были однотипные и взяты из одной коробки.
Теперь о конструкции излучателя света. Как видно на фотографиях, светодиоды в цепи не герметичны, а являются съемной частью конструкции.

Родная лампочка выпотрошена, и сделано 4 надреза во фланце с 4 сторон (одна уже была). 4 светодиода расположены симметрично по кругу. Положительные клеммы (согласно схеме) припаиваются к основанию возле вырезов, а отрицательные вставляются изнутри в центральное отверстие основания, срезаются и также припаиваются. «Ламповый диод» вставлен вместо обычной лампы накаливания.

Тестирование:
Стабилизация выходного напряжения (3.3 В) продолжалось до тех пор, пока напряжение питания не упало до ~ 1,2 В. Ток нагрузки в этом случае был около 100 мА (~ 25 мА на диод). Затем выходное напряжение стало плавно уменьшаться. Схема перешла на другой режим работы, при котором уже не стабилизируется, а выдает все, что может. В этом режиме он работал до напряжения питания 0,5В! При этом выходное напряжение упало до 2,7 В, а ток со 100 мА до 8 мА.

Немного об эффективности.
КПД схемы около 63% при свежих батареях.Дело в том, что используемые в схеме миниатюрные дроссели имеют чрезвычайно высокое омическое сопротивление – около 1,5 Ом.
Решение – кольцо из микропермаллоя с проницаемостью около 50.
40 витков провода ПЭВ-0,25, в один слой – получилось около 80 мкГс. Активное сопротивление около 0,2 Ом, а ток насыщения по расчетам более 3А. Изменяем выходной и входной электролит на 100 мкФ, хотя без ущерба для эффективности мы можем уменьшить его до 47 мкФ.

Схема светодиодного фонарика на DC / DC преобразователе от Analog Device – ADP1110.

Типовая схема подключения ADP1110.
Данный преобразователь микросхем, согласно спецификации производителя, доступен в 8 версиях:

Модель Выходное напряжение
ADP1110AN Регулируемый
ADP1110AR Регулируемый
ADP1110AN-3.3 3,3 В
ADP1110AR-3.3 3,3 В
ADP1110AN-5 5 В
ADP1110AR-5 5 В
ADP1110AN-12 12 В
ADP1110AR-12 12 В

Микросхемы с индексами «N» и «R» различаются только типом корпуса: R более компактный.
Если вы купили микросхему с индексом -3,3, можно пропустить следующий абзац и перейти к пункту «Подробности».
Если нет, то представляю вашему вниманию еще одну схему:


Она складывает две части, чтобы получить на выходе необходимые 3,3 вольта для питания светодиодов.
Схема может быть улучшена, если учесть, что для работы светодиодов требуется источник тока, а не напряжение. Изменения в схеме, чтобы она выдавала 60мА (по 20 на каждый диод), а напряжение на диодах нам выставлялось автоматически, такое же 3,3-3,9В.

резистор R1 используется для измерения тока. Конвертер сконструирован таким образом, что когда напряжение на выводе FB (обратная связь) превышает 0.22 В, он закончит увеличивать напряжение и ток, а это значит, что значение сопротивления R1 может быть легко вычислено R1 = 0,22 В / В, в нашем случае 3,6 Ом. Такая схема помогает стабилизировать ток и автоматически подбирать необходимое напряжение. К сожалению, на этом сопротивлении будет падать напряжение, что приведет к снижению КПД, однако практика показала, что оно меньше того превышения, которое мы выбрали в первом случае. Я замерил выходное напряжение, оно составило 3.4 – 3,6 В. Параметры диодов при таком подключении тоже должны быть по возможности одинаковыми, иначе суммарный ток 60мА не распределяется между ними равномерно, и опять же, мы получим разную яркость.

Детали

1. Дроссель подойдет любой от 20 до 100 мкгенри с малым (менее 0,4 Ом) сопротивлением. На диаграмме показано 47 мкГн. Сделать можно самому – намотать около 40 витков провода ПЭВ-0,25 на кольцо из микропермаллоя проницаемостью около 50 типоразмером 10х4х5.
2. Диод Шоттки. 1N5818, 1N5819, 1N4148 или аналогичный. Analog Device НЕ РЕКОМЕНДУЕТ использовать 1N4001
3. Конденсаторы. 47-100 мкФ при 6-10 вольт. Рекомендуется использовать тантал.
4. Резисторы. При мощности 0,125 Вт при сопротивлении 2 Ом возможно 300 кОм и 2,2 кОм.
5. Светодиоды. L-53PWC – 4 шт.

Преобразователь напряжения для питания белого светодиода DFL-OSPW5111P яркостью 30 Кд при токе 80 мА и ширине диаграммы направленности около 12 °.


Ток, потребляемый от батареи 2,41 В, составляет 143 мА; при этом через светодиод протекает ток около 70 мА при напряжении 4,17 В. Преобразователь работает на частоте 13 кГц, электрический КПД составляет около 0,85.
Трансформатор Т1 намотан на кольцевом магнитопроводе типоразмера К10х6х3 из феррита 2000 НМ.

Первичная и вторичная обмотки трансформатора намотаны одновременно (т. Е. Четырьмя проводами).
Первичная обмотка содержит – 2х41 виток провода ПЭВ-2 0.19,
Вторичная обмотка содержит – 2х44 витка провода ПЭВ-2 0,16.
После намотки выводы обмотки подключаются в соответствии со схемой.

Транзисторы КТ529А структуры p-n-p можно заменить на КТ530A структуры n-p-n, в этом случае необходимо изменить полярность подключения батареи GB1 и светодиода HL1.
Детали устанавливаются на отражатель с помощью шарнирного крепления. Обратите внимание на то, что был исключен контакт деталей с жестяной пластиной фонаря, питающей «минус» батареи GB1.Транзисторы скрепляются зажимом из тонкой латуни, обеспечивающим необходимый отвод тепла, а затем приклеиваются к отражателю. Светодиод ставится вместо лампы накаливания так, чтобы он выступал на 0,5 … 1 мм из патрона для ее установки. Это улучшает отвод тепла от светодиода и упрощает установку.
При первом включении питание от АКБ подается через резистор сопротивлением 18 … 24 Ом, чтобы не повредить транзисторы при неправильном подключении выводов трансформатора Т1.Если светодиод не горит, необходимо поменять местами крайние выводы первичной или вторичной обмотки трансформатора. Если это не привело к успеху, проверьте исправность всех элементов и правильность установки.

Преобразователь напряжения для питания светодиодного фонаря промышленного образца.

Преобразователь напряжения для питания светодиодного фонарика
Схема взята из мануала Zetex по использованию микросхем ZXSC310.
ZXSC310 – микросхема драйвера светодиода.
FMMT 617 или FMMT 618.
диод Шоттки – практически любой марки.
Конденсаторы C1 = 2,2 мкФ и C2 = 10 мкФ для поверхностного монтажа, 2,2 мкФ – это значение, рекомендованное производителем, а C2 может поставляться от 1 до 10 мкФ

Индуктор 68 микрогенри при 0,4 A

Индуктивность и резистор устанавливаются с одной стороны платы (там, где нет печати), все остальные части – с другой.Единственная уловка – это сделать резистор на 150 миллиом. Его можно сделать из железной проволоки толщиной 0,1 мм, которую можно получить, раскрутив кабель. Провод следует отжечь на зажигалке, тщательно протереть мелкой наждачной бумагой, облучать концы и впаять кусок длиной около 3 см в отверстия на плате. Далее в процессе настройки необходимо, измеряя ток через диоды, перемещать провод, одновременно нагревая паяльником место его припайки к плате.

Таким образом, получается что-то вроде реостата. Достигнув тока 20 мА, паяльник снимается, а ненужный кусок проволоки отрезается. У автора вышла длина около 1 см.

Фонарик на источнике питания


Рис. 3. Фонарик на источнике тока, с автоматическим выравниванием тока в светодиодах, так что светодиоды могут быть с любым разбросом параметров (светодиод VD2 устанавливает ток, который повторяют транзисторы VT2, VT3, таким образом, токи в ответвления будут одинаковые)
Транзисторы, конечно, тоже должны быть такими же, но разброс их параметров не столь критичен, поэтому можно брать либо дискретные транзисторы, либо, если удастся, три интегральных транзистора в одном корпусе , их параметры максимально совпадают.Поэкспериментируйте с размещением светодиодов, нужно выбрать пару светодиод-транзистор, чтобы выходное напряжение было минимальным, это повысит КПД.
Введение транзисторов выровняло яркость, но у них есть сопротивление и падение напряжения на них, что вынуждает преобразователь увеличивать выходной уровень до 4В, для уменьшения падения напряжения на транзисторах можно предложить схему на рис. , это модифицированное токовое зеркало, вместо опорного напряжения Ube = 0.7 В в схеме на рис. 3, вы можете использовать источник 0,22 В, встроенный в преобразователь, и поддерживать его в коллекторе VT1 с помощью операционной системы, также встроенной в преобразователь.


Рис. 4. Фонарик на источнике питания, с автоматическим выравниванием тока в светодиодах и повышенной эффективностью

Поскольку выход операционного усилителя имеет тип «открытый коллектор», его необходимо «подтянуть» к источнику питания, что делает резистор R2. Резисторы R3, R4 действуют как делитель напряжения в точке V2 на 2, поэтому операционный усилитель будет поддерживать напряжение 0.22 * 2 = 0,44 В в точке V2, что на 0,3 В меньше, чем в предыдущем случае. Делитель еще меньше брать для того, чтобы в точке V2 понизить напряжение нельзя, так как биполярный транзистор имеет сопротивление Rke и при работе на нем напряжение Uke будет падать, так что транзистор работает правильно, V2-V1 должно быть больше Uke, для нашего случая вполне достаточно 0,22V. Однако биполярные транзисторы можно заменить полевыми транзисторами, у которых сопротивление сток-исток намного меньше, это позволит уменьшить делитель, чтобы разница V2-V1 была совсем незначительной.

Дроссель. Дроссель нужно брать с минимальным сопротивлением, особое внимание следует обращать на максимально допустимый ток, он должен быть около 400 -1000 мА.
Номинальный ток не имеет такого значения, как максимальный ток, поэтому Analog Devices рекомендует диапазон от 33 до 180 мкГн. При этом теоретически, если не обращать внимание на габариты, то чем больше индуктивность, тем лучше по всем параметрам. Однако на практике это не совсем так, так как у нас не идеальная катушка, она имеет активное сопротивление и не является линейной, к тому же ключевой транзистор при малых напряжениях уже не будет выдавать 1.5А. Поэтому лучше попробовать несколько катушек разного типа, конструкции и разной мощности, чтобы выбрать катушку с наибольшим КПД и наименьшим минимальным входным напряжением, т.е. катушку, от которой фонарик будет светиться как можно дольше.

Конденсаторы.
C1 может быть любым. С2 лучше брать с танталом, потому что он имеет небольшое сопротивление, это увеличивает КПД.

Диод Шоттки.
Любая на ток до 1А, желательно с минимальным сопротивлением и минимальным падением напряжения.

Транзисторы.
Любая с током коллектора до 30 мА, кал. Усиление тока порядка 80 с частотой до 100 МГц подойдет КТ318.

светодиодов.
Банка белая NSPW500BS яркостью 8000 мкд от Power Light Systems.

Трансформатор напряжения
ADP1110 или его замена ADP1073, чтобы использовать его, необходимо изменить схему на рис. 3, взять дроссель 760 мкГс и R1 = 0,212 / 60 мА = 3,5 Ом.

Фонарик для ADP3000-ADJ

Опции:
Источник питания 2.8-10 В, КПД ок. 75%, два режима яркости – полная и половинная.
Ток через диоды 27 мА, в режиме половинной яркости – 13 мА.
Для получения высокого КПД в схеме желательно использовать компоненты микросхемы.
Правильно собранная схема не требует регулировки.
Недостатком схемы является высокое (1,25В) напряжение на входе FB (вывод 8).
В настоящее время выпускаются DC / DC преобразователи с напряжением FB около 0,3В, в частности, компанией Maxim, на которых реально достичь КПД выше 85%.


Схема фонаря на Кр1446ПН1.

Резисторы R1 и R2 являются датчиком тока. Операционный усилитель U2B – усиливает напряжение, снимаемое с датчика тока. Коэффициент усиления = R4 / R3 + 1 и составляет приблизительно 19. Требуемый коэффициент усиления таков, что когда ток через резисторы R1 и R2 равен 60 мА, выходное напряжение включает транзистор Q1. Меняя эти резисторы, вы можете установить другие значения тока стабилизации.
В принципе, операционный усилитель можно не устанавливать.Просто вместо R1 и R2 ставится один резистор на 10 Ом, с него сигнал через резистор 1кОм подается на базу транзистора и все. Но. Это приведет к снижению эффективности. На резисторе 10 Ом при токе 60 мА зря тратится 0,6 В – 36 мВт. В случае использования операционного усилителя потери будут:
на резисторе 0,5 Ом при токе 60 мА = 1,8 мВт + потребление самого ОУ 0,02 мА пусть при 4 В = 0,08 мВт
= 1.88 мВт – значительно меньше 36 мВт.

О компонентах.

Вместо KR1446UD2 может работать любой маломощный операционный усилитель с низким минимальным напряжением питания, лучше OP193FS, но это довольно дорого. Транзистор в корпусе SOT23. Полярный конденсатор поменьше – типа ПС 10 вольт. Индуктивность CW68 100 мкГн при токе 710 мА. Хотя ток отключения преобразователя составляет 1 А, он работает нормально. С ним была получена наилучшая эффективность. Подбирал светодиоды на максимально одинаковое падение напряжения при токе 20 мА.Собрал фонарик в футляре на две батарейки АА. Я сократил место для батареек до размера AAA, и на освободившемся месте собрал эту схему, подвесив крепление. Хорошо подойдет чехол для трех батареек АА. Вам останется только поставить две, а схему разместить на месте третьей.

КПД полученного устройства.
Вход U I P Выход U I P КПД
Вольт мА мВт Вольт мА мВт%
3,03 90 273 3,53 62 219 80
1.78 180 320 3,53 62 219 68
1,28 290 371 3,53 62 219 59

Замена лампочки фонарика «Жучек» на фирменный модуль Luxeon Lumiled LXHL – NW 98.
Получаем ослепительно яркий фонарик, с очень легким жимом лежа (по сравнению с лампочкой ).

Схема изменения и параметры модуля.

StepUP DC-DC преобразователи Преобразователи ADP1110 от Analog devices.


Электропитание: 1 или 2 батареи 1.5 В, работоспособность сохраняется до U вход = 0,9 В
Потребление:
* с разомкнутым переключателем S1 = 300 мА
* с замкнутым переключателем S1 = 110 мА

Светодиодный электронный фонарь
Питание от одной пальцевой батарейки AA или AAA микросхема (КР1446ПН1), которая является полным аналогом микросхемы MAX756 (MAX731) и имеет практически идентичные характеристики.


За основу взята лампа, в которой в качестве источника питания используются две батарейки АА (аккумуляторные).
Плата преобразователя помещается в фонарик вместо второго аккумулятора. С одного конца платы припаян луженый контакт для питания схемы, а с другого – светодиод. На выводы светодиода надевается кружок из такой же жести. Диаметр круга должен быть немного больше диаметра основания отражателя (на 0,2-0,5 мм), в которое вставляется картридж. Один из выводов диода (минус) припаивается к кругу, второй (плюс) проходит насквозь и заизолирован куском поливинилхлоридной или фторопластовой трубки.У круга двоякая цель. Он придает конструкции необходимую жесткость и одновременно служит для замыкания отрицательного контакта цепи. Лампа с патроном заранее снимается с фонаря и на ее место ставится схема со светодиодом. Перед установкой на плату выводы светодиодов укорачиваются таким образом, чтобы обеспечить плотную беззазорную посадку «на место». Обычно длина выводов (без учета пайки к плате) равна длине выступающей части полностью вкрученного цоколя лампы.
Схема подключения платы и аккумулятора представлена ​​на рис. 9.2.
Далее фонарь собирается и проверяется его работоспособность. Если схема собрана правильно, то никаких настроек не требуется.

В конструкции использованы стандартные элементы установки: конденсаторы типа К50-35, индукторы ЕС-24 индуктивностью 18-22 мкГн, светодиоды яркостью 5-10 кд диаметром 5 или 10 мм. Конечно, можно использовать другие светодиоды с напряжением питания 2.4-5 В. Схема имеет достаточный запас мощности и позволяет запитать даже светодиоды с яркостью до 25 кд!

О некоторых результатах тестирования этой конструкции.
Доработанный таким образом фонарик проработал от «свежего» аккумулятора без перебоев, во включенном состоянии более 20 часов! Для сравнения – тот же фонарик в «стандартной» комплектации (то есть с лампой и двумя «свежими» батареями из одной партии) проработал всего 4 часа.
И еще один важный момент.Если в этой конструкции используются аккумуляторные батареи, то следить за состоянием их уровня разряда несложно. Дело в том, что преобразователь на микросхеме КР1446ПН1 стабильно запускается при входном напряжении 0,8-0,9 В. Причем свечение светодиодов стабильно яркое, пока напряжение на АКБ не достигнет этого критического порога. Лампа, конечно, будет гореть при таком напряжении, но вряд ли можно говорить о ней как о реальном источнике света.

Рис. 9.2 Рисунок 9.3


Печатная плата устройства представлена ​​на рис.9.3, а расположение элементов – на рис. 9.4.

Включение и выключение фонарика одной кнопкой


Схема собрана на микросхеме D-триггера CD4013 и полевом транзисторе IRF630 в режиме «выключено». ток потребления схемы практически равен 0. Для стабильной работы D-триггера на входе микросхемы подключены резистор фильтра и конденсатор; их функция заключается в устранении дребезга контактов.Неиспользуемые выводы микросхемы лучше нигде не подключать. Микросхема работает от 2 до 12 вольт; любой мощный полевой транзистор можно использовать в качестве переключателя мощности, поскольку сопротивление сток-исток полевого транзистора незначительно и не нагружает выход микросхемы.

CD4013A в корпусе SO-14, аналог К561ТМ2, 564ТМ2

Схемы простых генераторов.
Позволяют запитать светодиод напряжением зажигания 2-3В от 1-1.5В. Короткие импульсы повышенного потенциала разблокируют pn переход. КПД конечно снижается, но это устройство позволяет «выжать» практически весь свой ресурс из автономного источника питания.
Проволока 0,1 мм – 100-300 витков с ответвлением от середины, намотанная на тороидальное кольцо.

Диммируемый светодиодный маяк

Питание микросхемы – генератора с регулируемым рабочим циклом (К561ЛЕ5 или 564ЛЕ5), управляющего электронным ключом, в предлагаемом устройстве осуществляется с повышающего преобразователь напряжения, позволяющий запитать лампу от одного гальванического элемента 1.5.
Преобразователь выполнен на транзисторах VT1, VT2 по схеме трансформаторного автогенератора с положительной обратной связью по току.
Схема генератора с регулируемой скважностью на вышеупомянутой микросхеме К561ЛЕ5 была немного изменена с целью улучшения линейности регулирования тока.
Минимальный ток потребления фонарика с шестью параллельно включенными сверхъяркими белыми светодиодами L-53MWC от Kingbnght составляет 2,3 мА. Зависимость потребления тока от количества светодиодов прямо пропорциональна.
Реализован режим «Маяк», когда светодиоды с низкой частотой ярко мигают, а затем гаснут, реализован при установке регулятора яркости на максимум и повторном включении фонарика. Желаемая частота световых вспышек регулируется подбором конденсатора С3.
Работоспособность фонарика сохраняется при падении напряжения до 1,1 В, хотя яркость значительно уменьшается.
В качестве электронного ключа использовался полевой транзистор KP501A (KR1014KT1V) с изолированным затвором.По схеме управления хорошо согласуется с микросхемой К561ЛЕ5. Транзистор КП501А имеет следующие ограничивающие параметры: напряжение сток-исток 240 В; напряжение затвор-исток – 20 В. Ток стока – 0,18 А; мощность – 0,5 Вт
Допускается параллельное включение транзисторов, желательно из одной партии. Возможная замена – КП504 с любым буквенным индексом. Для полевых транзисторов IRF540 напряжение питания DD1. вырабатываемый преобразователем должен быть увеличен до 10 В
В лампе с шестью параллельно подключенными светодиодами L-53MWC потребление тока составляет примерно 120 мА, когда второй транзистор подключен параллельно VT3 – 140 мА
Трансформатор T1 намотан кольцо ферритовое 2000НМ К10-6 “4.5. Обмотки намотаны двумя проводами, причем конец первой обмотки соединен с началом второй обмотки. Первичная обмотка содержит 2-10 витков, вторичная – 2 * 20 витков. Диаметр проволоки – 0,37 мм. Торговая марка – ПЭВ-2. Дроссель намотан на одном магнитопроводе без зазора с таким же проводом в один слой, количество витков 38. Индуктивность дросселя 860 мкГн




Схема преобразователя для Светодиод от 0.От 4 до 3V – питание от одной батарейки AAA. Этот фонарик повышает входное напряжение до необходимого напряжения с помощью простого преобразователя постоянного тока в постоянный.




Выходное напряжение составляет примерно 7 вольт (зависит от напряжения установленных светодиодов).

Сборка светодиодной фары





Что касается трансформатора в преобразователе постоянного тока. Вы должны сделать это сами. На изображении показано, как собрать трансформатор.

Другой вариант для светодиодных преобразователей _http: //belza.cz/ledlight/ledm.htm


Фонарик на свинцово-кислотном герметичном аккумуляторе с зарядным устройством .

Свинцово-кислотные герметичные аккумуляторные батареи в настоящее время являются самыми дешевыми. Электролит в них имеет форму геля, поэтому батареи могут работать в любом пространственном положении и не выделяют вредных паров. Они отличаются большой прочностью, если не допускается глубокий разряд.Теоретически перезарядки они не боятся, но не стоит злоупотреблять этим. Аккумуляторы можно заряжать в любое время, не дожидаясь их полной разрядки.
Свинцово-кислотные герметичные аккумуляторные батареи подходят для использования в переносных фонариках, используемых в домашнем хозяйстве, на дачных участках и на производстве.


Рис. 1. Схема электрического фонаря

Принципиальная электрическая схема фонаря с зарядным устройством для 6-вольтового аккумулятора, простым способом предотвращающим глубокую разрядку аккумулятора и тем самым увеличивающим срок его службы, представлена показано на рисунке.Он содержит заводской или самодельный трансформаторный блок питания и зарядное устройство-коммутационное устройство, установленное в корпусе лампы.
В авторской версии в качестве блока трансформатора используется стандартный блок, предназначенный для питания модемов. Выходное переменное напряжение блока – 12 или 15 В, ток нагрузки – 1 А. Встречаются такие блоки и со встроенными выпрямителями. Они также подходят для этой цели.
Переменное напряжение от трансформаторного блока поступает на зарядно-коммутационное устройство, содержащее вилку для подключения зарядного устройства Х2, диодный мост VD1, стабилизатор тока (DA1, R1, HL1), аккумулятор GB, тумблер S1, аварийный выключатель S2, лампа накаливания HL2.Каждый раз при включении тумблера S1 на реле К1 поступает напряжение аккумулятора, его контакты К1.1 замыкаются, подводя ток к базе транзистора VT1. Транзистор включается при пропускании тока через лампу HL2. Выключение фонарика производится переводом тумблера S1 в исходное положение, при котором аккумулятор отсоединяется от катушки реле К1.
Допустимое напряжение разряда АКБ выбрано на уровне 4,5 В. Оно определяется напряжением включения реле К1.Изменить допустимое значение напряжения разряда можно с помощью резистора R2. С увеличением номинала резистора допустимое напряжение разряда увеличивается, и наоборот. Если напряжение АКБ ниже 4,5 В, реле не включится, следовательно, на базу транзистора VT1, включающего лампу HL2, не будет подаваться напряжение. Это означает, что аккумулятор требует зарядки. При напряжении 4,5 В освещенность, создаваемая фонариком, неплохая. В экстренных случаях можно включить фонарик на пониженном напряжении кнопкой S2, при условии, что тумблер S1 включен.
На вход устройства переключения заряда также может подаваться постоянное напряжение, независимо от полярности подключаемых устройств.
Для перевода фонаря в режим зарядки необходимо состыковать розетку X1 трансформаторного блока с вилкой X2, находящейся на корпусе лампы, а затем включить вилку (на рисунке не показана) трансформаторного блока в сеть 220 В.
В приведенном выше варианте используется аккумулятор емкостью 4,2 Ач. Следовательно, его можно заряжать током 0.42 А. Аккумулятор заряжается постоянным током. Стабилизатор тока состоит всего из трех частей: интегрального стабилизатора напряжения DA1 типа КР142ЕН5А или импортного 7805, светодиода HL1 и резистора R1. Светодиод, помимо работы в стабилизаторе тока, также служит индикатором режима заряда аккумулятора.
Наладка электрической схемы фонаря сводится к регулировке тока заряда аккумулятора. Зарядный ток (в амперах) обычно выбирается в десять раз меньше числового значения емкости аккумулятора (в ампер-часах).
Для настройки лучше всего собрать схему регулятора тока отдельно. Вместо аккумуляторной нагрузки подключить к месту соединения катода светодиода и резистора R1 амперметр на ток 2… 5 А. Подбирая резистор R1, выставляем рассчитанный ток заряда по амперметру.
Реле К1 – геркон РЭС64, паспорт РС4.569.724. Лампа HL2 потребляет ток примерно 1 А.
Транзистор КТ829 можно использовать с любым буквенным индексом. Эти транзисторы составные и имеют высокий коэффициент усиления по току 750.Это следует учитывать при замене.
В авторском варианте микросхема DA1 установлена ​​на стандартном ребристом радиаторе размером 40x50x30 мм. Резистор R1 состоит из двух последовательно соединенных резисторов с проволочной обмоткой мощностью 12 Вт.

Схемы:



РЕМОНТ СВЕТОДИОДНОГО ФОНАРА

Характеристики деталей (C, D, R)
C = 1 мкФ. R1 = 470 кОм. R2 = 22 кОм.
1Д, 2Д – КД105А (допустимое напряжение 400В, предельный ток 300 мА.)
Обеспечивает:
зарядный ток = 65 – 70 мА.
напряжение = 3,6 В.

LED-Treiber PR4401 SOT23




Здесь вы можете увидеть, к чему привели результаты эксперимента.

Предлагаемая вашему вниманию схема использовалась для питания светодиодного фонарика, подзарядки мобильного телефона от двух металлогидритовых батарей, для создания микроконтроллерного устройства, радиомикрофона. В любом случае схема работала безупречно.Список того, где можно использовать MAX1674, можно продолжать до бесконечности.

Самый простой способ получить более или менее стабильный ток через светодиод – это подключить его к нерегулируемому источнику питания через резистор. При этом следует учитывать, что напряжение питания должно быть как минимум в два раза больше рабочего напряжения светодиода. Ток через светодиод рассчитывается по формуле:
I led = (Umax.pit – U рабочий диод): R1

Эта схема предельно проста и во многих случаях оправдана, но ее следует использовать там, где в этом нет необходимости. для экономии электроэнергии, а к надежности нет высоких требований.
Более стабильные схемы, основанные на линейных стабилизаторах:


В качестве стабилизаторов лучше выбирать регулируемые, либо на фиксированное напряжение, но оно должно быть максимально приближенным к напряжению на светодиоде или цепочке подключенных светодиодов последовательно.
Стабилизаторы типа LM 317 очень подходят.
Немецкий текст: iel war es, mit nur einer NiCd-Zelle (AAA, 250mAh) eine der neuen ultrahellen LEDs mit 5600mCd zu betreiben. Светодиоды Diese Benötigen 3,6V / 20mA. Ich habe Ihre Schaltung zunächst unverändert übernommen, als Induktivität hatte ich аллергены nur eine mit 1,4mH zur Hand.Die Schaltung lief auf Anhieb! Allerdings ließ die Leuchtstärke doch noch zu wünschen übrig. Больше света, светодиоды, светодиоды, светодиоды, параллельные светодиоды! ??? Tatsächlich waren es nur die Messschnüre, bzw. deren Kapazität, die den Effekt bewirkten. Mit einem Oszilloskop konnte ich dann feststellen, dass in dem Moment die Frequenz stark anstieg. Hm, также habe ich den 100nF-Kondensator gegen einen 4,7nF Typ ausgetauscht und schon war die Helligkeit wie gewünscht.Anschließend habe ich dann nur noch durch Ausprobieren die best Spule aus meiner Sammlung gesucht … Das beste Ergebnis hatte ich mit einem alten Sperrkreis für den 19KHz Pilotton (UKW), aus dem ich die Kreiskapazit Mini :

Источники:
http://pro-radio.ru/
http://radiokot.ru/

СВОБОДНЫЙ ПАРАМЕТРИЧЕСКИЙ СТАБИЛИЗАТОР НА ТРАНЗИСТОРЕ И СТАБИЛИЗАТОР

Поделиться

Штифт

Твитнуть

Отправить

Поделиться

Отправить

Как известно, ни одно электронное устройство не работает без подходящего источника питания.В простейшем случае источником питания может выступать обычный трансформатор и диодный мост (выпрямитель) со сглаживающим конденсатором. Однако не всегда под рукой есть трансформатор на нужное напряжение. И уж тем более такой источник питания нельзя назвать стабилизированным, ведь напряжение на его выходе будет зависеть от напряжения в сети.
Вариант решения этих двух проблем – использование стандартных стабилизаторов, например 78L05, 78L12. Им удобно пользоваться, но, опять же, не всегда под рукой.Другой вариант – использовать параметрический стабилизатор на стабилитроне и транзисторе. Его схема представлена ​​ниже.

Схема стабилизатора


VD1-VD4 на этой схеме представляет собой обычный диодный мост, преобразующий переменное напряжение от трансформатора в постоянное. Конденсатор C1 сглаживает пульсации напряжения, переводя напряжение с пульсирующего на постоянное. Параллельно с этим конденсатором стоит поставить пленочный или керамический конденсатор небольшой емкости для фильтрации высокочастотных пульсаций, т.к. на высокой частоте электролитический конденсатор плохо справляется.Электролитические конденсаторы C2 и C3 в этой цепи служат для той же цели – сглаживания любых пульсаций. Цепочка R1 – VD5 служит для формирования стабилизированного напряжения, резистор R1 в ней задает ток стабилизации стабилитрона. Резистор R2 нагрузки. Транзистор в этой схеме поглощает всю разницу между входным и выходным напряжением, поэтому на нем рассеивается приличное количество тепла. Эта схема не предназначена для подключения мощной нагрузки, но, тем не менее, транзистор следует прикрутить к радиатору с помощью теплопроводящей пасты.
Напряжение на выходе схемы зависит от выбора стабилитрона и номинала резисторов. В таблице ниже приведены номиналы элементов для приема на выходе 5, 6, 9, 12, 15 вольт.
Вместо транзистора КТ829А можно использовать импортные аналоги, например, TIP41 или BDX53. Допускается установка диодного моста любого подходящего по току и напряжению. Кроме того, его можно собрать из отдельных диодов. Таким образом, при использовании минимума деталей получается работоспособный стабилизатор напряжения, от которого можно запитать другие электронные устройства, потребляющие небольшой ток.

Фото стабилизатора, которое я собрал:


Плата устройства

schema.zip 3,05 Кб (скачиваний: 206)


Автор: Дмитрий Сергеевич

Поделиться

Штифт

Твитнуть

Отправить

Поделиться

Отправить

Посмотрите видео: Что такое стабилитрон? Стабилитрон как регулятор напряжения на решенных примерах (ноябрь 2021 г.).

.

Добавить комментарий

Ваш адрес email не будет опубликован.